Chapter-06 Molecular Basis of Inheritance
In the previous chapter, you have learnt the inheritance patterns and the genetic basis of such patterns. At the time of Mendel, the nature of those ‘factors’ regulating the pattern of inheritance was not clear. Over the next hundred years, the nature of the putative genetic material was investigated culminating in the realisation that DNA - deoxyribonucleic acid - is the genetic material, at least for the majority of organisms. In class XI you have learnt that nucleic acids are polymers of nucleotides.
Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are the two types of nucleic acids found in living systems. DNA acts as the genetic material in most of the organisms. RNA though it also acts as a genetic material in some viruses, mostly functions as a messenger. RNA has additional roles as well. It functions as adapter, structural, and in some cases as a catalytic molecule. In Class XI you have already learnt the structures of nucleotides and the way these monomer units are linked to form nucleic acid polymers. In this chapter we are going to discuss the structure of DNA, its replication, the process of making RNA from DNA (transcription), the genetic code that determines the sequences of amino acids in proteins, the process of protein synthesis (translation) and elementary basis of their regulation. The determination of complete nucleotide sequence of human genome during last decade has set in a new era of genomics. In the last section, the essentials of human genome sequencing and its consequences will also be discussed.
Let us begin our discussion by first understanding the structure of the most interesting molecule in the living system, that is, the DNA. In subsequent sections, we will understand that why it is the most abundant genetic material, and what its relationship is with RNA.
6.1 THE DNA
DNA is a long polymer of deoxyribonucleotides. The length of DNA is usually defined as number of nucleotides (or a pair of nucleotide referred to as base pairs) present in it. This also is the characteristic of an organism. For example, a bacteriophage known as φ ×174 has 5386 nucleotides, Bacteriophage lambda has 48502 base pairs (bp), Escherichia coli has 4.6 × 106 bp, and haploid content of human DNA is 3.3 × 109 bp. Let us discuss the structure of such a long polymer.
6.1.1 Structure of Polynucleotide Chain
Let us recapitulate the chemical structure of a polynucleotide chain (DNA or RNA). A nucleotide has three components - a nitrogenous base, a pentose sugar (ribose in case of RNA, and deoxyribose for DNA), and a phosphate group. There are two types of nitrogenous bases - Purines (Adenine and Guanine), and Pyrimidines (Cytosine, Uracil and Thymine). Cytosine is common for both DNA and RNA and Thymine is present in DNA. Uracil is present in RNA at the place of Thymine. A nitrogenous base is linked to the OH of 1’ C pentose sugar through a N-glycosidic linkage to form a nucleoside, such as adenosine or deoxyadenosine, guanosine or deoxyguanosine, cytidine or deoxycytidine and uridine or deoxythymidine. When a phosphate group is linked to OH of 5’ C of a nucleoside through phosphoester linkage, a corresponding nucleotide (or deoxynucleotide depending upon the type of sugar present) is formed. Two nucleotides are linked through 3’-5’ phosphodiester linkage to form a dinucleotide. More nucleotides can be joined in such a manner to form a polynucleotide chain. A polymer thus formed has at one end a free phosphate moiety at 5’ -end of sugar, which is referred to as 5’-end of polynucleotide chain. Similarly, at the other end of the polymer the sugar has a free OH of 3’ C group which is referred to as 3’ - end of the polynucleotide chain. The backbone of a polynucleotide chain is formed due to sugar and phosphates. The nitrogenous bases linked to sugar moiety project from the backbone (Figure 6.1).
Figure 6.1 A Polynucleotide chain
In RNA, every nucleotide residue has an additional –OH group present at 2’ -position in the ribose. Also, in RNA the uracil is found at the place of thymine (5-methyl uracil, another chemical name for thymine).
DNA as an acidic substance present in nucleus was first identified by Friedrich Meischer in 1869. He named it as ‘Nuclein’. However, due to technical limitation in isolating such a long polymer intact, the elucidation of structure of DNA remained elusive for a very long period of time. It was only in 1953 that James Watson and Francis Crick, based on the X-ray diffraction data produced by Maurice Wilkins and Rosalind Franklin, proposed a very simple but famous Double Helix model for the structure of DNA. One of the hallmarks of their proposition was base pairing between the two strands of polynucleotide chains. However, this proposition was also based on the observation of Erwin Chargaff that for a double stranded DNA, the ratios between Adenine and Thymine and Guanine and Cytosine are constant and equals one.
The base pairing confers a very unique property to the polynucleotide chains. They are said to be complementary to each other, and therefore if the sequence of bases in one strand is known then the sequence in other strand can be predicted. Also, if each strand from a DNA (let us call it as a parental DNA) acts as a template for synthesis of a new strand, the two double stranded DNA (let us call them as daughter DNA) thus, produced would be identical to the parental DNA molecule. Because of this, the genetic implications of the structure of DNA became very clear.
The salient features of the Double-helix structure of DNA are as follows:
(i) It is made of two polynucleotide chains, where the backbone is constituted by sugar-phosphate, and the bases project inside.
(ii) The two chains have anti-parallel polarity. It means, if one chain has the polarity 5’ à3’ , the other has 3 ’ à5 ’ .
(iii) The bases in two strands are paired through hydrogen bond (H-bonds) forming base pairs (bp). Adenine forms two hydrogen bonds with Thymine from opposite strand and vice-versa. Similarly, Guanine is bonded with Cytosine with three H-bonds. As a result, always a purine comes opposite to a pyrimidine. This generates approximately uniform distance between the two strands of the helix (Figure 6.2).
Figure 6.2 Double stranded polynucleotide chain
(iv) The two chains are coiled in a right-handed fashion. The pitch of the helix is 3.4 nm (a nanometre is one billionth of a metre, that is 10-9 m) and there are roughly 10 bp in each turn. Consequently, the distance between a bp in a helix approximately 0.34 nm.
(v) The plane of one base pair stacks over the other in double helix. This, in addition to H-bonds, confers stability of the helical structure (Figure 6.3).
Figure 6.3 DNA double helix
Compare the structure of purines and pyrimidines. Can you find out why the distance between two polynucleotide chains in DNA remains almost constant?
The proposition of a double helix structure for DNA and its simplicity in explaining the genetic implication became revolutionary. Very soon, Francis Crick proposed the Central dogma in molecular biology, which states that the genetic information flows from DNA $\rightarrow$ RNA $\rightarrow$ Protein.
In some viruses the flow of information is in reverse direction, that is, from RNA to DNA. Can you suggest a simple name to the process?
6.1.2 Packaging of DNA Helix
Taken the distance between two consecutive base pairs as 0.34 nm (0.34×10–9 m), if the length of DNA double helix in a typical mammalian cell is calculated (simply by multiplying the total number of bp with distance between two consecutive bp, that is, 6.6 × 109 bp × 0.34 × 10-9 m/bp), it comes out to be approximately 2.2 metres. A length that is far greater than the dimension of a typical nucleus (approximately 10–6 m). How is such a long polymer packaged in a cell?
If the length of E. coli DNA is 1.36 mm, can you calculate the number of base pairs in E.coli?
In prokaryotes, such as, E. coli, though they do not have a defined nucleus, the DNA is not scattered throughout the cell. DNA (being negatively charged) is held with some proteins (that have positive charges) in a region termed as ‘nucleoid’. The DNA in nucleoid is organised in large loops held by proteins.
Figure 6.4 a Nucleosome
Figure 6.4 b E M picture - ‘Beads-on-String’
In eukaryotes, this organisation is much more complex. There is a set of positively charged, basic proteins called histones. A protein acquires charge depending upon the abundance of amino acids residues with charged side chains. Histones are rich in the basic amino acid residues lysine and arginine. Both the amino acid residues carry positive charges in their side chains. Histones are organised to form a unit of eight molecules called histone octamer.
The negatively charged DNA is wrapped around the positively charged histone octamer to form a structure called nucleosome (Figure 6.4 a). A typical nucleosome contains 200 bp of DNA helix. Nucleosomes constitute the repeating unit of a structure in nucleus called chromatin, threadlike stained (coloured) odies seen in nucleus. The nucleosomes in chromatin are seen as ‘beads-on-string’ structure when viewed under electron microscope (EM) (Figure 6.4 b).
Theoretically, how many such beads (nucleosomes) do you imagine are present in a mammalian cell?
The beads-on-string structure in chromatin is packaged to form chromatin fibers that are further coiled and condensed at metaphase stage of cell division to form chromosomes. The packaging of chromatin at higher level requires additional set of proteins that collectively are referred to as Non-histone Chromosomal (NHC) proteins. In a typical nucleus, some region of chromatin are loosely packed (and stains light) and are referred to as euchromatin. The chromatin that is more densely packed and stains dark are called as Heterochromatin. Euchromatin is said to be transcriptionally active chromatin, whereas heterochromatin is inactive.
6.2 THE SEARCH FOR GENETIC MATERIAL
Even though the discovery of nuclein by Meischer and the proposition for principles of inheritance by Mendel were almost at the same time, but that the DNA acts as a genetic material took long to be discovered and proven. By 1926, the quest to determine the mechanism for genetic inheritance had reached the molecular level. Previous discoveries by Gregor Mendel, Walter Sutton, Thomas Hunt Morgan and numerous other scientists had narrowed the search to the chromosomes located in the nucleus of most cells. But the question of what molecule was actually the genetic material, had not been answered.
Transforming Principle - In 1928, Frederick Griffith, in a series of experiments with Streptococcus pneumoniae (bacterium responsible for pneumonia), witnessed a miraculous transformation in the bacteria. During the course of his experiment, a living organism (bacteria) had changed in physical form.
When Streptococcus pneumoniae (pneumococcus) bacteria are grown on a culture plate, some produce smooth shiny colonies (S) while others produce rough colonies (R). This is because the S strain bacteria have a mucous (polysaccharide) coat, while R strain does not. Mice infected with the S strain (virulent) die from pneumonia infection but mice infected with the R strain do not develop pneumonia.
S strain $\rightarrow$ Inject into mice $\rightarrow$ Mice die
R strain $\rightarrow$ Inject into mice $\rightarrow$ Mice live
Griffith was able to kill bacteria by heating them. He observed that heat-killed S strain bacteria injected into mice did not kill them. When he injected a mixture of heat-killed S and live R bacteria, the mice died. Moreover, he recovered living S bacteria from the dead mice. He concluded that the R strain bacteria had somehow been transformed by the heat-killed S strain bacteria. Some ‘transforming principle’, transferred from the heat-killed S strain, had enabled the R strain to synthesise a smooth polysaccharide coat and become virulent. This must be due to the transfer of the genetic material. However, the biochemical nature of genetic material was not defined from his experiments.
Biochemical Characterisation of Transforming Principle - Prior to the work of Oswald Avery, Colin MacLeod and Maclyn McCarty (1933-44), the genetic material was thought to be a protein. They worked to determine the biochemical nature of ‘transforming principle’ in Griffith’s experiment.
They purified biochemicals (proteins, DNA, RNA, etc.) from the heat-killed S cells to see which ones could transform live R cells into S cells. They discovered that DNA alone from S bacteria caused R bacteria to become transformed.
They also discovered that protein-digesting enzymes (proteases) and RNA-digesting enzymes (RNases) did not affect transformation, so the transforming substance was not a protein or RNA. Digestion with DNase did inhibit transformation, suggesting that the DNA caused the transformation. They concluded that DNA is the hereditary material, but not all biologists were convinced.
Can you think of any difference between DNAs and DNase?
6.2.1 The Genetic Material is DNA
The unequivocal proof that DNA is the genetic material came from the experiments of Alfred Hershey and Martha Chase (1952). They worked with viruses that infect bacteria called bacteriophages.
The bacteriophage attaches to the bacteria and its genetic material then enters the bacterial cell. The bacterial cell treats the viral genetic material as if it was its own and subsequently manufactures more virus particles. Hershey and Chase worked to discover whether it was protein or DNA from the viruses that entered the bacteria.
They grew some viruses on a medium that contained radioactive phosphorus and some others on medium that contained radioactive sulfur. Viruses grown in the presence of radioactive phosphorus contained radioactive DNA but not radioactive protein because DNA contains phosphorus but protein does not. Similarly, viruses grown on radioactive sulfur contained radioactive protein but not radioactive DNA because DNA does not contain sulfur.
Radioactive phages were allowed to attach to E. coli bacteria. Then, as the infection proceeded, the viral coats were removed from the bacteria by agitating them in a blender. The virus particles were separated from the bacteria by spinning them in a centrifuge.
Bacteria which was infected with viruses that had radioactive DNA were radioactive, indicating that DNA was the material that passed from the virus to the bacteria. Bacteria that were infected with viruses that had radioactive proteins were not radioactive. This indicates that proteins did not enter the bacteria from the viruses. DNA is therefore the genetic material that is passed from virus to bacteria (Figure 6.5).
Figure 6.5 The Hershey-Chase experiment
6.2.2 Properties of Genetic Material (DNA versus RNA)
From the foregoing discussion, it is clear that the debate between proteins versus DNA as the genetic material was unequivocally resolved from Hershey-Chase experiment. It became an established fact that it is DNA that acts as genetic material. However, it subsequently became clear that in some viruses, RNA is the genetic material (for example, Tobacco Mosaic viruses, QB bacteriophage, etc.). Answer to some of the questions such as, why DNA is the predominant genetic material, whereas RNA performs dynamic functions of messenger and adapter has to be found from the differences between chemical structures of the two nucleic acid molecules.
Can you recall the two chemical differences between DNA and RNA?
A molecule that can act as a genetic material must fulfill the following criteria:
(i) It should be able to generate its replica (Replication).
(ii) It should be stable chemically and structurally.
(iii) It should provide the scope for slow changes (mutation) that are required for evolution.
(iv) It should be able to express itself in the form of ‘Mendelian Characters’.
If one examines each requirement one by one, because of rule of base pairing and complementarity, both the nucleic acids (DNA and RNA) have the ability to direct their duplications. The other molecules in the living system, such as proteins fail to fulfill first criteria itself.
The genetic material should be stable enough not to change with different stages of life cycle, age or with change in physiology of the organism. Stability as one of the properties of genetic material was very evident in Griffith’s ‘transforming principle’ itself that heat, which killed the bacteria, at least did not destroy some of the properties of genetic material. This now can easily be explained in light of the DNA that the two strands being complementary if separated by heating come together, when appropriate conditions are provided. Further, 2’ -OH group present at every nucleotide in RNA is a reactive group and makes RNA labile and easily degradable. RNA is also now known to be catalytic, hence reactive. Therefore, DNA chemically is less reactive and structurally more stable when compared to RNA. Therefore, among the two nucleic acids, the DNA is a better genetic material.
In fact, the presence of thymine at the place of uracil also confers additional stability to DNA. (Detailed discussion about this requires understanding of the process of repair in DNA, and you will study these processes in higher classes.)
Both DNA and RNA are able to mutate. In fact, RNA being unstable, mutate at a faster rate. Consequently, viruses having RNA genome and having shorter life span mutate and evolve faster.
RNA can directly code for the synthesis of proteins, hence can easily express the characters. DNA, however, is dependent on RNA for synthesis of proteins. The protein synthesising machinery has evolved around RNA. The above discussion indicate that both RNA and DNA can function as genetic material, but DNA being more stable is preferred for storage of genetic information. For the transmission of genetic information, RNA is better.
6.3 RNA WORLD
From foregoing discussion, an immediate question becomes evident - which is the first genetic material? It shall be discussed in detail in the chapter on chemical evolution, but briefly, we shall highlight some of the facts and points.
RNA was the first genetic material. There is now enough evidence to suggest that essential life processes (such as metabolism, translation, splicing, etc.), evolved around RNA. RNA used to act as a genetic material as well as a catalyst (there are some important biochemical reactions in living systems that are catalysed by RNA catalysts and not by protein enzymes). But, RNA being a catalyst was reactive and hence unstable. Therefore, DNA has evolved from RNA with chemical modifications that make it more stable. DNA being double stranded and having complementary strand further resists changes by evolving a process of repair.
6.4 REPLICATION
While proposing the double helical structure for DNA, Watson and Crick had immediately proposed a scheme for replication of DNA. To quote their original statement that is as follows:
Figure 6.6 Watson-Crick model for semiconservative DNA replication
‘‘It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material’’ (Watson and Crick, 1953).
The scheme suggested that the two strands would separate and act as a template for the synthesis of new complementary strands. After the completion of replication, each DNA molecule would have one parental and one newly synthesised strand. This scheme was termed as semiconservative DNA replication (Figure 6.6).
6.4.1 The Experimental Proof
It is now proven that DNA replicates semiconservatively. It was shown first in Escherichia coli and subsequently in higher organisms, such as plants and human cells. Matthew Meselson and Franklin Stahl performed the following experiment in 1958:
(i) They grew E. coli in a medium containing 15NH4Cl (15N is the heavy isotope of nitrogen) as the only nitrogen source for many generations. The result was that 15N was incorporated into newly synthesised DNA (as well as other nitrogen containing compounds). This heavy DNA molecule could be distinguished from the normal DNA by centrifugation in a cesium chloride (CsCl) density gradient (Please note that 15N is not a radioactive isotope, and it can be separated from 14N only based on densities).
(ii) Then they transferred the cells into a medium with normal NH4Cl and took samples at various definite time intervals as the cells multiplied, and extracted the DNA that remained as double-stranded helices. The various samples were separated independently on CsCl gradients to measure the densities of DNA (Figure 6.7).
Figure 6.7 Meselson and Stahl’s Experiment
Can you recall what centrifugal force is, and think why a molecule with higher mass/density would sediment faster?
(iii) Thus, the DNA that was extracted from the culture one generation after the transfer from 15N to 14N medium [that is after 20 minutes; E. coli divides in 20 minutes] had a hybrid or intermediate density. DNA extracted from the culture after another generation [that is after 40 minutes, II generation] was composed of equal amounts of this hybrid DNA and of ‘light’ DNA.
If E. coli was allowed to grow for 80 minutes then what would be the proportions of light and hybrid densities DNA molecule?
Very similar experiments involving use of radioactive thymidine to detect distribution of newly synthesised DNA in the chromosomes was performed on Vicia faba (faba beans) by Taylor and colleagues in 1958. The experiments proved that the DNA in chromosomes also replicate semiconservatively.
6.4.2 The Machinery and the Enzymes
In living cells, such as E. coli, the process of replication requires a set of catalysts (enzymes). The main enzyme is referred to as DNA-dependent DNA polymerase, since it uses a DNA template to catalyse the polymerisation of deoxynucleotides. These enzymes are highly efficient enzymes as they have to catalyse polymerisation of a large number of nucleotides in a very short time. E. coli that has only 4.6 × 106 bp (compare it with human whose diploid content is 6.6 × 109 bp), completes the process of replication within 18 minutes; that means the average rate of polymerisation has to be approximately 2000 bp per second. Not only do these polymerases have to be fast, but they also have to catalyse the reaction with high degree of accuracy. Any mistake during replication would result into mutations. Furthermore, energetically replication is a very expensive process. Deoxyribonucleoside triphosphates serve dual purposes. In addition to acting as substrates, they provide energy for polymerisation reaction (the two terminal phosphates in a deoxynucleoside triphosphates are high-energy phosphates, same as in case of ATP).
In addition to DNA-dependent DNA polymerases, many additional enzymes are required to complete the process of replication with high degree of accuracy. For long DNA molecules, since the two strands of DNA cannot be separated in its entire length (due to very high energy requirement), the replication occur within a small opening of the DNA helix, referred to as replication fork. The DNA-dependent DNA polymerases catalyse polymerisation only in one direction, that is 5’ à3’ . This creates some additional complications at the replicating fork. Consequently, on one strand (the template with polarity 3’ à5’ ), the replication is continuous, while on the other (the template with polarity 5’ à3’ ), it is discontinuous. The discontinuously synthesised fragments are later joined by the enzyme DNA ligase (Figure 6.8).
Figure 6.8 Replicating Fork
The DNA polymerases on their own cannot initiate the process of replication. Also the replication does not initiate randomly at any place in DNA. There is a definite region in E. coli DNA where the replication originates. Such regions are termed as origin of replication. It is because of the requirement of the origin of replication that a piece of DNA if needed to be propagated during recombinant DNA procedures, requires a vector. The vectors provide the origin of replication.
Further, not every detail of replication is understood well. In eukaryotes, the replication of DNA takes place at S-phase of the cell-cycle. The replication of DNA and cell division cycle should be highly coordinated. A failure in cell division after DNA replication results into polyploidy(a chromosomal anomaly). You will learn the detailed nature of origin and the processes occurring at this site, in higher classes.
6.5 TRANSCRIPTION
The process of copying genetic information from one strand of the DNA into RNA is termed as transcription. Here also, the principle of complementarity governs the process of transcription, except the adenosine complements now forms base pair with uracil instead of thymine. However, unlike in the process of replication, which once set in, the total DNA of an organism gets duplicated, in transcription only a segment of DNA and only one of the strands is copied into RNA. This necessitates defining the boundaries that would demarcate the region and the strand of DNA that would be transcribed.
Why both the strands are not copied during transcription has the simple answer. First, if both strands act as a template, they would code for RNA molecule with different sequences (Remember complementarity does not mean identical), and in turn, if they code for proteins, the sequence of amino acids in the proteins would be different. Hence, one segment of the DNA would be coding for two different proteins, and this would complicate the genetic information transfer machinery. Second, the two RNA molecules if produced simultaneously would be complementary to each other, hence would form a double stranded RNA. This would prevent RNA from being translated into protein and the exercise of transcription would become a futile one.
6.5.1 TRANSCRIPTION UNIT
A transcription unit in DNA is defined primarily by the three regions in the DNA :
(i) A Promoter
(ii) The Structural gene
(iii) A Terminator
There is a convention in defining the two strands of the DNA in the structural gene of a transcription unit. Since the two strands have opposite polarity and the DNA-dependent RNA polymerase also catalyse the polymerisation in only one direction, that is, 5’ →3’ , the strand that has the polarity 3’ →5’ acts as a template, and is also referred to as template strand. The other strand which has the polarity (5’ →3’ ) and the sequence same as RNA (except thymine at the place of uracil), is displaced during transcription. Strangely, this strand (which does not code for anything) is referred to as coding strand. All the reference point while defining a transcription unit is made with coding strand. To explain the point, a hypothetical sequence from a transcription unit is represented below:
3’ -ATGCATGCATGCATGCATGCATGC-5’ Template Strand
5’ -TACGTACGTACGTACGTACGTACG-3’ Coding Strand
Can you now write the sequence of RNA transcribed from the above DNA?
Figure 6.9 Schematic structure of a transcription unit
The promoter and terminator flank the structural gene in a transcription unit. The promoter is said to be located towards 5’ -end (upstream) of the structural gene (the reference is made with respect to the polarity of coding strand). It is a DNA sequence that provides binding site for RNA polymerase, and it is the presence of a promoter in a transcription unit that also defines the template and coding strands. By switching its position with terminator, the definition of coding and template strands could be reversed. The terminator is located towards 3’ -end (downstream) of the coding strand and it usually defines the end of the process of transcription (Figure 6.9). There are additional regulatory sequences that may be present further upstream or downstream to the promoter. Some of the properties of these sequences shall be discussed while dealing with regulation of gene expression.
6.5.2 Transcription Unit and the Gene
A gene is defined as the functional unit of inheritance. Though there is no ambiguity that the genes are located on the DNA, it is difficult to literally define a gene in terms of DNA sequence. The DNA sequence coding for tRNA or rRNA molecule also define a gene. However by defining a cistron as a segment of DNA coding for a polypeptide, the structural gene in a transcription unit could be said as monocistronic (mostly in eukaryotes) or polycistronic (mostly in bacteria or prokaryotes). In eukaryotes, the monocistronic structural genes have interrupted coding sequences - the genes in eukaryotes are split. The coding sequences or expressed sequences are defined as exons. Exons are said to be those sequence that appear in mature or processed RNA. The exons are interrupted by introns. Introns or intervening sequences do not appear in mature or processed RNA. The split-gene arrangement further complicates the definition of a gene in terms of a DNA segment.
Inheritance of a character is also affected by promoter and regulatory sequences of a structural gene. Hence, sometime the regulatory sequences are loosely defined as regulatory genes, even though these sequences do not code for any RNA or protein.
6.5.3 Types of RNA and the process of Transcription
In bacteria, there are three major types of RNAs: mRNA (messenger RNA), tRNA (transfer RNA), and rRNA (ribosomal RNA). All three RNAs are needed to synthesise a protein in a cell. The mRNA provides the template, tRNA brings aminoacids and reads the genetic code, and rRNAs play structural and catalytic role during translation. There is single DNA-dependent RNA polymerase that catalyses transcription of all types of RNA in bacteria. RNA polymerase binds to promoter and initiates transcription (Initiation). It uses nucleoside triphosphates as substrate and polymerises in a template depended fashion following the rule of complementarity. It somehow also facilitates opening of the helix and continues elongation. Only a short stretch of RNA remains bound to the enzyme. Once the polymerases reaches the terminator region, the nascent RNA falls off, so also the RNA polymerase. This results in termination of transcription.
An intriguing question is that how is the RNA polymerases able to catalyse all the three steps, which are initiation, elongation and termination. The RNA polymerase is only capable of catalysing the process of elongation. It associates transiently with initiation-factor (σ) and termination-factor (ρ) to initiate and terminate the transcription, respectively. Association with these factors alter the specificity of the RNA polymerase to either initiate or terminate (Figure 6.10).
Figure 6.10 Process of Transcription in Bacteria
In bacteria, since the mRNA does not require any processing to become active, and also since transcription and translation take place in the same compartment (there is no separation of cytosol and nucleus in bacteria), many times the translation can begin much before the mRNA is fully transcribed. Consequently, the transcription and translation can be coupled in bacteria.
In eukaryotes, there are two additional complexities –
(i) There are at least three RNA polymerases in the nucleus (in addition to the RNA polymerase found in the organelles). There is a clear cut division of labour. The RNA polymerase I transcribes rRNAs (28S, 18S, and 5.8S), whereas the RNA polymerase III is responsible for transcription of tRNA, 5srRNA, and snRNAs (small nuclear RNAs). The RNA polymerase II transcribes precursor of mRNA, the heterogeneous nuclear RNA (hnRNA).
Figure 6.11 Process of Transcription in Eukaryotes
(ii) The second complexity is that the primary transcripts contain both the exons and the introns and are non-functional. Hence, it is subjected to a process called splicing where the introns are removed and exons are joined in a defined order. hnRNA undergoes additional processing called as capping and tailing. In capping an unusual nucleotide (methyl guanosine triphosphate) is added to the 5’ -end of hnRNA. In tailing, adenylate residues (200-300) are added at 3’ -end in a template independent manner. It is the fully processed hnRNA, now called mRNA, that is transported out of the nucleus for translation (Figure 6.11).
The significance of such complexities is now beginning to be understood. The split-gene arrangements represent probably an ancient feature of the genome. The presence of introns is reminiscent of antiquity, and the process of splicing represents the dominance of RNA-world. In recent times, the understanding of RNA and RNA-dependent processes in the living system have assumed more importance.
6.6 GENETIC CODE
During replication and transcription a nucleic acid was copied to form another nucleic acid. Hence, these processes are easy to conceptualise on the basis of complementarity. The process of translation requires transfer of genetic information from a polymer of nucleotides to synthesise a polymer of amino acids. Neither does any complementarity exist between nucleotides and amino acids, nor could any be drawn theoretically. There existed ample evidences, though, to support the notion that change in nucleic acids (genetic material) were responsible for change in amino acids in proteins. This led to the proposition of a genetic code that could direct the sequence of amino acids during synthesis of proteins.
If determining the biochemical nature of genetic material and the structure of DNA was very xciting, the proposition and deciphering of genetic code were most challenging. In a very true ense, it required involvement of scientists from several disciplines - physicists, organic hemists, biochemists and geneticists. It was George Gamow, a physicist, who argued that since here are only 4 bases and if they have to code for 20 amino acids, the code should constitute a ombination of bases. He suggested that in order to code for all the 20 amino acids, the code hould be made up of three nucleotides. This was a very bold proposition, because a permutation ombination of 43 (4 × 4 × 4) would generate 64 codons; generating many more codons than required. instrumental in synthesising RNA molecules with defined combinations of bases (homopolymers and copolymers). Marshall Nirenberg’s cell-free system for protein synthesis finally helped the code to be deciphered. Severo Ochoa enzyme (polynucleotide phosphorylase) was also helpful in polymerising RNA with defined sequences in a template independent manner (enzymatic synthesis of RNA). Finally a checker-board for genetic code was prepared which is given in Table 6.1.
Table 5.1: The Codons for the Various Amino Acids
The salient features of genetic code are as follows:
(i) The codon is triplet. 61 codons code for amino acids and 3 codons do not code for any amino acids, hence they function as stop codons.
(ii) Some amino acids are coded by more than one codon, hence the code is degenerate.
(iii) The codon is read in mRNA in a contiguous fashion. There are no punctuations.
(iv) The code is nearly universal: for example, from bacteria to human UUU would code for Phenylalanine (phe). Some exceptions to this rule have been found in mitochondrial codons, and in some protozoans.
(v) AUG has dual functions. It codes for Methionine (met) , and it also act as initiator codon.
(vi) UAA, UAG, UGA are stop terminator codons.
If following is the sequence of nucleotides in mRNA, predict the sequence of amino acid coded by it (take help of the checkerboard): -AUG UUU UUC UUC UUU UUU UUC-
Now try the opposite. Following is the sequence of amino acids coded by an mRNA. Predict the nucleotide sequence in the RNA:
Met-Phe-Phe-Phe-Phe-Phe-Phe
Do you face any difficulty in predicting the opposite?
Can you now correlate which two properties of genetic code you have learnt?
6.6.1 Mutations and Genetic Code
The relationships between genes and DNA are best understood by mutation studies. You have studied about mutation and its effect in Chapter 5. Effects of large deletions and rearrangements in a segment of DNA are easy to comprehend. It may result in loss or gain of a gene and so a function. The effect of point mutations will be explained here. A classical example of point mutation is a change of single base pair in the gene for beta globin chain that results in the change of amino acid residue glutamate to valine. It results into a diseased condition called as sickle cell anemia. Effect of point mutations that inserts or deletes a base in structural gene can be better understood by following simple example.
Consider a statement that is made up of the following words each having three letters like genetic code.
RAM HAS RED CAP
If we insert a letter $\mathrm{B}$ in between HAS and RED and rearrange the statement, it would read as follows:
RAM HAS BRE DCA P
Similarly, if we now insert two letters at the same place, say $\mathrm{BI}$. Now it would read,
RAM HAS BIR EDC AP
Now we insert three letters together, say $\mathrm{BIG}$, the statement would read
RAM HAS BIG RED CAP
The same exercise can be repeated, by deleting the letters R, E and D, one by one and rearranging the statement to make a triplet word.
RAM HAS EDC AP
RAM HAS DCA P
RAM HAS CAP
The conclusion from the above exercise is very obvious. Insertion or deletion of one or two bases changes the reading frame from the point of insertion or deletion. However, such mutations are referred to as frameshift insertion or deletion mutations. Insertion or deletion of three or its multiple bases insert or delete in one or multiple codon hence one or multiple amino acids, and reading frame remains unaltered from that point onwards.
6.6.2 tRNA– the Adapter Molecule
From the very beginning of the proposition of code, it was clear to Francis Crick that there has to be a mechanism to read the code and also to link it to the amino acids, because amino acids have no structural specialities to read the code uniquely. He postulated the presence of an adapter molecule that would on one hand read the code and on other hand would bind to specific amino acids. The tRNA, then called sRNA (soluble RNA), was known before the genetic code was postulated. However, its role as an adapter molecule was assigned much later.
Figure 6.12 tRNA - the adapter molecule
tRNA has an anticodon loop that has bases complementary to the code, and it also has an amino acid acceptor end to which it binds to amino acids. tRNAs are specific for each amino acid (Figure 6.12). For initiation, there is another specific tRNA that is referred to as initiator tRNA. There are no tRNAs for stop codons. In figure 6.12, the secondary structure of tRNA has been depicted that looks like a clover-leaf. In actual structure, the tRNA is a compact molecule which looks like inverted L.
6.7 TRANSLATION
Translation refers to the process of polymerisation of amino acids to form a polypeptide (Figure 6.13). The order and sequence of amino acids are defined by the sequence of bases in the mRNA. The amino acids are joined by a bond which is known as a peptide bond. Formation of a peptide bond requires energy. Therefore, in the first phase itself amino acids are activated in the presence of ATP and linked to their cognate tRNA - a process commonly called as charging of tRNA or aminoacylation of tRNA to be more specific. If two such charged tRNAs are brought close enough, the formation of peptide bond between them would be favoured energetically. The presence of a catalyst would enhance the rate of peptide bond formation.
Figure 6.13 Translation
The cellular factory responsible for synthesising proteins is the ribosome. The ribosome consists of structural RNAs and about 80 different proteins. In its inactive state, it exists as two subunits; a large subunit and a small subunit. When the small subunit encounters an mRNA, the process of translation of the mRNA to protein begins. There are two sites in the large subunit, for subsequent amino acids Figure 6.13 Translation to bind to and thus, be close enough to each other for the formation of a peptide bond. The ribosome also acts as a catalyst (23S rRNA in bacteria is the enzyme- ribozyme) for the formation of peptide bond.
A translational unit in mRNA is the sequence of RNA that is flanked by the start codon (AUG) and the stop codon and codes for a polypeptide. An mRNA also has some additional sequences that are not translated and are referred as untranslated regions (UTR). The UTRs are present at both 5’ -end (before start codon) and at 3’ -end (after stop codon). They are required for efficient translation process.
For initiation, the ribosome binds to the mRNA at the start codon (AUG) that is recognised only by the initiator tRNA. The ribosome proceeds to the elongation phase of protein synthesis. During this stage, complexes composed of an amino acid linked to tRNA, sequentially bind to the appropriate codon in mRNA by forming complementary base pairs with the tRNA anticodon. The ribosome moves from codon to codon along the mRNA. Amino acids are added one by one, translated into Polypeptide sequences dictated by DNA and represented by mRNA. At the end, a release factor binds to the stop codon, terminating translation and releasing the complete polypeptide from the ribosome.
6.8 REGULATION OF GENE EXPRESSION
Regulation of gene expression refers to a very broad term that may occur at various levels. Considering that gene expression results in the formation of a polypeptide, it can be regulated at several levels. In eukaryotes, the regulation could be exerted at
(i) transcriptional level (formation of primary transcript),
(ii) processing level (regulation of splicing),
(iii) transport of mRNA from nucleus to the cytoplasm,
(iv) translational level.
The genes in a cell are expressed to perform a particular function or a set of functions. For example, if an enzyme called beta-galactosidase is synthesised by E. coli, it is used to catalyse the hydrolysis of a disaccharide, lactose into galactose and glucose; the bacteria use them as a source of energy. Hence, if the bacteria do not have lactose around them to be utilised for energy source, they would no longer require the synthesis of the enzyme beta-galactosidase. Therefore, in simple terms, it is the metabolic, physiological or environmental conditions that regulate the expression of genes. The development and differentiation of embryo into adult organisms are also a result of the coordinated regulation of expression of several sets of genes.
In prokaryotes, control of the rate of transcriptional initiation is the predominant site for control of gene expression. In a transcription unit, the activity of RNA polymerase at a given promoter is in turn regulated by interaction with accessory proteins, which affect its ability to recognise start sites. These regulatory proteins can act both positively (activators) and negatively (repressors). The accessibility of promoter regions of prokaryotic DNA is in many cases regulated by the interaction of proteins with sequences termed operators. The operator region is adjacent to the promoter elements in most operons and in most cases the sequences of the operator bind a repressor protein. Each operon has its specific operator and specific repressor. For example, lac operator is present only in the lac operon and it interacts specifically with lac repressor only.
6.8.1 The Lac Operon
The elucidation of the lac operon was also a result of a close association between a geneticist, Francois Jacob and a biochemist, Jacque Monod. They were the first to elucidate a transcriptionally regulated system. In lac operon (here lac refers to lactose), a polycistronic structural gene is regulated by a common promoter and regulatory genes. Such arrangement is very common in bacteria and is referred to as operon. To name few such examples, lac operon, trp operon, ara operon, his operon, val operon, etc.
The lac operon consists of one regulatory gene (the i gene - here the term i does not refer to inducer, rather it is derived from the word inhibitor) and three structural genes (z, y, and a). The i gene codes for the repressor of the lac operon. The z gene codes for beta-galactosidase (β-gal), which is primarily responsible for the hydrolysis of the disaccharide, lactose into its monomeric units, galactose and glucose. The y gene codes for permease, which increases permeability of the cell to β-galactosides. The a gene encodes a transacetylase. Hence, all the three gene products in lac operon are required for metabolism of lactose. In most other operons as well, the genes present in the operon are needed together to function in the same or related metabolic pathway (Figure 6.14).
Figure 6.14 The lac Operon
Lactose is the substrate for the enzyme beta-galactosidase and it regulates switching on and off of the operon. Hence, it is termed as inducer. In the absence of a preferred carbon source such as glucose, if lactose is provided in the growth medium of the bacteria, the lactose is transported into the cells through the action of permease (Remember, a very low level of expression of lac operon has to be present in the cell all the time, otherwise lactose cannot enter the cells). The lactose then induces the operon in the following manner.
The repressor of the operon is synthesised (all-the-time - constitutively) from the i gene. The repressor protein binds to the operator region of the operon and prevents RNA polymerase from transcribing the operon. In the presence of an inducer, such as lactose or allolactose, the repressor is inactivated by interaction with the inducer. This allows RNA polymerase access to the promoter and transcription proceeds (Figure 6.14). Essentially, regulation of lac operon can also be visualised as regulation of enzyme synthesis by its substrate.
Remember, glucose or galactose cannot act as inducers for lac operon. Can you think for how long the lac operon would be expressed in the presence of lactose?
Regulation of lac operon by repressor is referred to as negative regulation. Lac operon is under control of positive regulation as well, but it is beyond the scope of discussion at this level.
6.9 HUMAN GENOME PROJECT
In the preceding sections you have learnt that it is the sequence of bases in DNA that determines the genetic information of a given organism. In other words, genetic make-up of an organism or an individual lies in the DNA sequences. If two individuals differ, then their DNA sequences should also be different, at least at some places. These assumptions led to the quest of finding out the complete DNA sequence of human genome. With the establishment of genetic engineering techniques where it was possible to isolate and clone any piece of DNA and availability of simple and fast techniques for determining DNA sequences, a very ambitious project of sequencing human genome was launched in the year 1990.
Human Genome Project (HGP) was called a mega project. You can imagine the magnitude and the requirements for the project if we simply define the aims of the project as follows:
Human genome is said to have approximately 3 x 109 bp, and if the cost of sequencing required is US $ 3 per bp (the estimated cost in the beginning), the total estimated cost of the project would be approximately 9 billion US dollars. Further, if the obtained sequences were to be stored in typed form in books, and if each page of the book contained 1000 letters and each book contained 1000 pages, then 3300 such books would be required to store the information of DNA sequence from a single human cell. The enormous amount of data expected to be generated also necessitated the use of high speed computational devices for data storage and retrieval, and analysis. HGP was closely associated with the rapid development of a new area in biology called Bioinformatics.
Goals of HGP
Some of the important goals of HGP were as follows:
(i) Identify all the approximately 20,000-25,000 genes in human DNA;
(ii) Determine the sequences of the 3 billion chemical base pairs that make up human DNA;
(iii) Store this information in databases;
(iv) Improve tools for data analysis;
(v) Transfer related technologies to other sectors, such as industries;
(vi) Address the ethical, legal, and social issues (ELSI) that may arise from the project.
The Human Genome Project was a 13-year project coordinated by the U.S. Department of Energy and the National Institute of Health. During the early years of the HGP, the Wellcome Trust (U.K.) became a major partner; additional contributions came from Japan, France, Germany, China and others. The project was completed in 2003. Knowledge about the effects of DNA variations among individuals can lead to revolutionary new ways to diagnose, treat and someday prevent the thousands of disorders that affect human beings. Besides providing clues to understanding human biology, learning about non-human organisms DNA sequences can lead to an understanding of their natural capabilities that can be applied toward solving challenges in health care, agriculture, energy production, environmental remediation. Many non-human model organisms, such as bacteria, yeast, Caenorhabditis elegans (a free living non-pathogenic nematode), Drosophila (the fruit fly), plants (rice and Arabidopsis), etc., have also been sequenced.
Methodologies : The methods involved two major approaches. One approach focused on identifying all the genes that are expressed as RNA referred to as Expressed Sequence Tags (ESTs). The other took the blind approach of simply sequencing the whole set of genome that contained all the coding and non-coding sequence, and later assigning different regions in the sequence with functions (a term referred to as Sequence Annotation). For sequencing, the total DNA from a cell is isolated and converted into random fragments of relatively smaller sizes (recall DNA is a very long polymer, and there are technical limitations in sequencing very long pieces of DNA) and cloned in suitable host using specialised vectors. The cloning resulted into amplification of each piece of DNA fragment so that it subsequently could be sequenced with ease. The commonly used hosts were bacteria and yeast, and the vectors were called as BAC (bacterial artificial chromosomes), and YAC (yeast artificial chromosomes).
Figure 6.15 A representative diagram of human genome project
The fragments were sequenced using automated DNA sequencers that worked on the principle of a method developed by Frederick Sanger. (Remember, Sanger is also credited for developing method for determination of amino acid sequences in proteins). These sequences were then arranged based on some overlapping regions present in them. This required generation of overlapping fragments for sequencing. Alignment of these sequences was humanly not possible. Therefore, specialised computer based programs were developed (Figure 6.15). These sequences were subsequently annotated and were assigned to each chromosome. The sequence of chromosome 1 was completed only in May 2006 (this was the last of the 24 human chromosomes - 22 autosomes and X and Y - to be sequenced). Another challenging task was assigning the genetic and physical maps on the genome. This was generated using information on polymorphism of restriction endonuclease recognition sites, and some repetitive DNA sequences known as microsatellites (one of the applications of polymorphism in repetitive DNA sequences shall be explained in next section of DNA fingerprinting).
6.9.1 Salient Features of Human Genome
Some of the salient observations drawn from human genome project are as follows:
(i) The human genome contains 3164.7 million bp.
(ii) The average gene consists of 3000 bases, but sizes vary greatly, with the largest known human gene being dystrophin at 2.4 million bases.
(iii) The total number of genes is estimated at 30,000– much lower than previous estimates of 80,000 to 1,40,000 genes. Almost all (99.9 per cent) nucleotide bases are exactly the same in all people.
(iv) The functions are unknown for over 50 per cent of the discovered genes.
(v) Less than 2 per cent of the genome codes for proteins.
(vi) Repeated sequences make up very large portion of the human genome.
(vii) Repetitive sequences are stretches of DNA sequences that are repeated many times, sometimes hundred to thousand times. They are thought to have no direct coding functions, but they shed light on chromosome structure, dynamics and evolution.
(viii) Chromosome 1 has most genes (2968), and the Y has the fewest (231).
(ix) Scientists have identified about 1.4 million locations where singlebase DNA differences (SNPs - single nucleotide polymorphism, pronounced as ‘snips’) occur in humans. This information promises to revolutionise the processes of finding chromosomal locations for disease-associated sequences and tracing human history.
6.9.2 Applications and Future Challenges
Deriving meaningful knowledge from the DNA sequences will define research through the coming decades leading to our understanding of biological systems. This enormous task will require the expertise and creativity of tens of thousands of scientists from varied disciplines in both the public and private sectors worldwide. One of the greatest impacts of having the HG sequence may well be enabling a radically new approach to biological research. In the past, researchers studied one or a few genes at a time. With whole-genome sequences and new high-throughput technologies, we can approach questions systematically and on a much broader scale. They can study all the genes in a genome, for example, all the transcripts in a particular tissue or organ or tumor, or how tens of thousands of genes and proteins work together in interconnected networks to orchestrate the chemistry of life.
6.10 DNA FINGERPRINTING
As stated in the preceding section, 99.9 per cent of base sequence among humans is the same. Assuming human genome as 3 × 109 bp, in how many base sequences would there be differences? It is these differences in sequence of DNA which make every individual unique in their phenotypic appearance. If one aims to find out genetic differences between two individuals or among individuals of a population, sequencing the DNA every time would be a daunting and expensive task. Imagine trying to compare two sets of 3 × 10 base pairs. DNA fingerprinting is a very quick way to compare the DNA sequences of any two individuals.
DNA fingerprinting involves identifying differences in some specific regions in DNA sequence called as repetitive DNA, because in these sequences, a small stretch of DNA is repeated many times. These repetitive DNA are separated from bulk genomic DNA as different peaks during density gradient centrifugation. The bulk DNA forms a major peak and the other small peaks are referred to as satellite DNA. Depending on base composition (A : T rich or G:C rich), length of segment, and number of repetitive units, the satellite DNA is classified into many categories, such as micro-satellites, mini-satellites etc. These sequences normally do not code for any proteins, but they form a large portion of human genome. These sequence show high degree of polymorphism and form the basis of DNA fingerprinting. Since DNA from every tissue (such as blood, hair-follicle, skin, bone, saliva, sperm etc.), from an individual show the same degree of polymorphism, they become very useful identification tool in forensic applications. Further, as the polymorphisms are inheritable from parents to children, DNA fingerprinting is the basis of paternity testing, in case of disputes.
As polymorphism in DNA sequence is the basis of genetic mapping of human genome as well as of DNA fingerprinting, it is essential that we understand what DNA polymorphism means in simple terms. Polymorphism (variation at genetic level) arises due to mutations. (Recall different kind of mutations and their effects that you have already studied in Chapter 5, and in the preceding sections in this chapter.) New mutations may arise in an individual either in somatic cells or in the germ cells (cells that generate gametes in sexually reproducing organisms). If a germ cell mutation does not seriously impair individual’s ability to have offspring who can transmit the mutation, it can spread to the other members of population (through sexual reproduction). Allelic (again recall the definition of alleles from Chapter 5) sequence variation has traditionally been described as a DNA polymorphism if more than one variant (allele) at a locus occurs in human population with a frequency greater than 0.01. In simple terms, if an inheritable mutation is observed in a population at high frequency, it is referred to as DNA polymorphism. The robability of such variation to be observed in noncoding DNA sequence would be higher as utations in these sequences may not have any immediate effect/impact in an individual’s reproductive ability. These mutations keep on accumulating generation after generation, and form one of the basis of variability/polymorphism. There is a variety of different types of polymorphisms ranging from single nucleotide change to very large scale changes. For evolution and speciation, such polymorphisms play very important role, and you will study these in details at higher classes.
The technique of DNA Fingerprinting was initially developed by Alec Jeffreys. He used a satellite DNA as probe that shows very high degree of polymorphism. It was called as Variable Number of Tandem Repeats (VNTR). The technique, as used earlier, involved Southern blot hybridisation using radiolabelled VNTR as a probe. It included
(i) isolation of DNA,
(ii) digestion of DNA by restriction endonucleases,
(iii) separation of DNA fragments by electrophoresis,
(iv) transferring (blotting) of separated DNA fragments to synthetic membranes, such as nitrocellulose or nylon,
(v) hybridisation using labelled VNTR probe, and
(vi) detection of hybridised DNA fragments by autoradiography. A schematic representation of DNA fingerprinting is shown in Figure 6.16.
The VNTR belongs to a class of satellite DNA referred to as mini-satellite. A small DNA sequence is arranged tandemly in many copy numbers. The copy number varies from chromosome to chromosome in an individual. The numbers of repeat show very high degree of polymorphism. As a result the size of VNTR varies in size from 0.1 to 20 kb. Consequently, after hybridisation with VNTR probe, the autoradiogram gives many bands of differing sizes. These bands give a characteristic pattern for an individual DNA (Figure 6.16). It differs from individual to individual in a population except in the case of monozygotic (identical) twins. The sensitivity of the technique has been increased by use of polymerase chain reaction (PCR–you will study about it in Chapter 11). Consequently, DNA from a single cell is enough to perform DNA fingerprinting analysis. In addition to application in forensic science, it has much wider application, such as in determining population and genetic diversities. Currently, many different probes are used to generate DNA fingerprints.
Figure 6.16 Schematic representation of DNA fingerprinting : Few representative chromosomes have been shown to contain different copy number of VNTR. For the sake of understanding different colour schemes have been used to trace the origin of each band in the gel. The two alleles (paternal and maternal) of a chromosome also contain different copy numbers of VNTR. It is clear that the banding pattern of DNA from crime scene matches with individual B, and not with A.
Summary
Nucleic acids are long polymers of nucleotides. While DNA stores genetic information, RNA mostly helps in transfer and expression of information. Though DNA and RNA both function as genetic material, but DNA being chemically and structurally more stable is a better genetic material. However, RNA is the first to evolve and DNA was derived from RNA. The hallmark of the double stranded helical structure of DNA is the hydrogen bonding between the bases from opposite strands. The rule is that Adenine pairs with Thymine through two H-bonds, and Guanine with Cytosine through three H-bonds. This makes one strand complementary to the other. The DNA replicates semiconservatively, the process is guided by the complementary H-bonding. A segment of DNA that codes for RNA may in a simplistic term can be referred as gene. During transcription also, one of the strands of DNA acts a template to direct the synthesis of complementary RNA. In bacteria, the transcribed mRNA is functional, hence can directly be translated. In eukaryotes, the gene is split. The coding sequences, exons, are interrupted by non-coding sequences, introns. Introns are removed and exons are joined to produce functional RNA by splicing. The messenger RNA contains the base sequences that are read in a combination of three (to make triplet genetic code) to code for an amino acid. The genetic code is read again on the principle of complementarity by tRNA that acts as an adapter molecule. There are specific tRNAs for every amino acid. The tRNA binds to specific amino acid at one end and pairs through H-bonding with codes on mRNA through its anticodons. The site of translation (protein synthesis) is ribosomes, which bind to mRNA and provide platform for joining of amino acids. One of the rRNA acts as a catalyst for peptide bond formation, which is an example of RNA enzyme (ribozyme). Translation is a process that has evolved around RNA, indicating that life began around RNA. Since, transcription and translation are energetically very expensive processes, these have to be tightly regulated. Regulation of transcription is the primary step for regulation of gene expression. In bacteria, more than one gene is arranged together and regulated in units called as operons. Lac operon is the prototype operon in bacteria, which codes for genes responsible for metabolism of lactose. The operon is regulated by the amount of lactose in the medium where the bacteria are grown. Therefore, this regulation can also be viewed as regulation of enzyme synthesis by its substrate.
Human genome project was a mega project that aimed to sequence every base in human genome. This project has yielded much new information. Many new areas and avenues have opened up as a consequence of the project. DNA Fingerprinting is a technique to find out variations in individuals of a population at DNA level. It works on the principle of polymorphism in DNA sequences. It has immense applications in the field of forensic science, genetic biodiversity and evolutionary biology.
EXERCISES
1. Group the following as nitrogenous bases and nucleosides:Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
Show Answer
Answer
Nitrogenous bases present in the list are adenine, thymine, uracil, and cytosine.
Nucleosides present in the list are cytidine and guanosine.
2. If a double stranded DNA has 20 per cent of cytosine, calculate the percent of adenine in the DNA.
Show Answer
Answer
According to Chargaff’s rule, the DNA molecule should have an equal ratio of pyrimidine (cytosine and thymine) and purine (adenine and guanine). It means that the number of adenine molecules is equal to thymine molecules and the number of guanine molecules is equal to cytosine molecules.
$% \mathrm{~A}=% \mathrm{~T}$ and $% \mathrm{G}=% \mathrm{C}$
If dsDNA has $20 %$ of cytosine, then according to the law, it would have $20 %$ of guanine.
Thus, percentage of $\mathrm{G}+\mathrm{C}$ content $=40 %$
The remaining $60 %$ represents both $\mathrm{A}+\mathrm{T}$ molecule. Since adenine and guanine are always present in equal numbers, the percentage of adenine molecule is $30 %$.
3. If the sequence of one strand of DNA is written as follows:
5’ -ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5’ →3’ direction.
Show Answer
Answer
The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is
Then, the sequence of complementary strand in $5^{\prime}$ to $3^{\prime}$ direction will be
3’- TACGTACGTACGTACGTACGTACGTACG - 5'
Therefore, the sequence of nucleotides on DNA polypeptide in $5^{\prime}$ to $3^{\prime}$ direction is
5’- GCATGCATGCATGCATGCATGCATGCAT - 3'
5’- ATGCATGCATGCATGCATGCATGCATGC - 3'
4. If the sequence of the coding strand in a transcription unit is written as follows:
5’ -ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of mRNA.
Show Answer
Answer
If the coding strand in a transcription unit is
5’- ATGCATGCATGCATGCATGCATGCATGC-3'
Then, the template strand in $3^{\prime}$ to $5^{\prime}$ direction would be
3’ - TACGtACGTACGTACGTACGTACGTACG-5'
It is known that the sequence of mRNA is same as the coding strand of DNA.
However, in RNA, thymine is replaced by uracil.
Hence, the sequence of mRNA will be
5’ - AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3'
5. Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.
Show Answer
Answer
Watson and Crick observed that the two strands of DNA are anti-parallel and complementary to each other with respect to their base sequences. This type of arrangement in DNA molecule led to the hypothesis that DNA replication is semi-conservative. It means that the double stranded DNA molecule separates and then, each of the separated strand acts as a template for the synthesis of a new complementary strand. As a result, each DNA molecule would have one parental strand and a newly synthesized daughter strand.
Since only one parental strand is conserved in each daughter molecule, it is known as semi-conservative mode of replication.
novar $\rightarrow$ Novar
Parental Strand
Daughter strand
6. Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesised from it (DNA or RNA), list the types of nucleic acid polymerases.
Show Answer
Answer
There are two different types of nucleic acid polymerases.
(1) DNA-dependent DNA polymerases
(2) DNA-dependent RNA polymerases
The DNA-dependent DNA polymerases use a DNA template for synthesizing a new strand of DNA, whereas DNAdependent RNA polymerases use a DNA template strand for synthesizing RNA.
7. How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material?
Show Answer
Answer
Hershey and Chase worked with bacteriophage and E.coli to prove that DNA is the genetic material. They used different radioactive isotopes to label DNA and protein coat of the bacteriophage.
They grew some bacteriophages on a medium containing radioactive phosphorus $\left({ }^{32} \mathrm{P}\right)$ to identify DNA and some on a medium containing radioactive sulphur $\left({ }^{35} \mathrm{~S}\right)$ to identify protein. Then, these radioactive labelled phages were allowed to infect E.coli bacteria. After infecting, the protein coat of the bacteriophage was separated from the bacterial cell by blending and then subjected to the process of centrifugation.
Since the protein coat was lighter, it was found in the supernatant while the infected bacteria got settled at the bottom of the centrifuge tube. Hence, it was proved that DNA is the genetic material as it was transferred from virus to bacteria.
Hershey and Chase experiment
8. Differentiate between the followings:
(a) Repetitive DNA and Satellite DNA
(b) mRNA and tRNA
(c) Template strand and Coding strand
Show Answer
Answer
(a) Repetitive DNA and satellite DNA
| Repetitive DNA | Satellite DNA | |
|---|---|---|
| 1. | Repetitive DNA are DNA sequences that contain small segments, which are repeated many times. |
Satellite DNA are DNA sequences that contain highly repetitive DNA. |
(b) mRNA and tRNA
| mRNA | tRNA | |
|---|---|---|
| 1. | mRNA or messenger RNA acts as a template for the process of transcription. |
tRNA or transfer RNA acts as an adaptor molecule that carries a specific amino acid to mRNA for the synthesis of polypeptide. |
| 2. It is a linear molecule. | It has clover leaf shape. |
|---|
(c) Template strand and coding strand
| Template strand | Coding strand | |
|---|---|---|
| 1. | Template strand of DNA acts as a template for the synthesis of mRNA during transcription. |
Coding strand is a sequence of DNA that has the same base sequence as that of mRNA (except thymine that is replaced by uracil in DNA). |
| 2. It runs from 3’ to 5'. | It runs from 5’to 3'. |
9. List two essential roles of ribosome during translation.
Show Answer
Answer
The important functions of ribosome during translation are as follows.
(a) Ribosome acts as the site where protein synthesis takes place from individual amino acids. It is made up of two subunits.
The smaller subunit comes in contact with mRNA and forms a protein synthesizing complex whereas the larger subunit acts as an amino acid binding site.
(b) Ribosome acts as a catalyst for forming peptide bond. For example, 23s $r$-RNA in bacteria acts as a ribozyme.
10. In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then, why does lac operon shut down some time after addition of lactose in the medium?
Show Answer
Answer
Lac operon is a segment of DNA that is made up of three adjacent structural genes, namely, an operator gene, a promoter gene, and a regulator gene. It works in a coordinated manner to metabolize lactose into glucose and galactose.
In lac operon, lactose acts as an inducer. It binds to the repressor and inactivates it. Once the lactose binds to the repressor, RNA polymerase binds to the promoter region. Hence, three structural genes express their product and respective enzymes are produced. These enzymes act on lactose so that lactose is metabolized into glucose and galactose.
After sometime, when the level of inducer decreases as it is completely metabolized by enzymes, it causes synthesis of the repressor from regulator gene. The repressor binds to the operator gene and prevents RNA polymerase from transcribing the operon. Hence, the transcription is stopped. This type of regulation is known as negative regulation.
Repressor
11. Explain (in one or two lines) the function of the followings:
(a) Promoter
(b) tRNA
(c) Exons
Show Answer
Answer
(a) Promoter
Promoter is a region of DNA that helps in initiating the process of transcription. It serves as the binding site for RNA polymerase.
(b) tRNA
tRNA or transfer RNA is a small RNA that reads the genetic code present on mRNA. It carries specific amino acid to mRNA on ribosome during translation of proteins.
(c) Exons
Exons are coding sequences of DNA in eukaryotes that transcribe for proteins.
12. Why is the Human Genome project called a mega project?
Show Answer
Answer
Human genome project was considered to be a mega project because it had a specific goal to sequence every base pair present in the human genome. It took around 13 years for its completion and got accomplished in year 2006. It was a large scale project, which aimed at developing new technology and generating new information in the field of genomic studies. As a result of it, several new areas and avenues have opened up in the field of genetics, biotechnology, and medical sciences. It provided clues regarding the understanding of human biology.
13. What is DNA fingerprinting? Mention its application.
Show Answer
Answer
DNA fingerprinting is a technique used to identify and analyze the variations in various individuals at the level of DNA. It is based on variability and polymorphism in DNA sequences.
Application
(1) It is used in forensic science to identify potential crime suspects.
(2) It is used to establish paternity and family relationships.
(3) It is used to identify and protect the commercial varieties of crops and livestock.
(4) It is used to find out the evolutionary history of an organism and trace out the linkages between groups of various organisms.
14. Briefly describe the following:
(a) Transcription
(b) Polymorphism
(c) Translation
(d) Bioinformatics
Show Answer
Answer
(a) Transcription
Transcription is the process of synthesis of RNA from DNA template. A segment of DNA gets copied into mRNA during the process. The process of transcription starts at the promoter region of the template DNA and terminates at the terminator region. The segment of DNA between these two regions is known as transcription unit. The transcription requires RNA polymerase enzyme, a DNA template, four types of ribonucleotides, and certain cofactors such as $\mathrm{Mg}^{2+}$.
The three important events that occur during the process of transcription are as follows.
(i) Initiation
(ii) Elongation
(iii) Termination
The DNA-dependent RNA polymerase and certain initiation factors ( $\tilde{A} E^{\prime}$ ) bind at the double stranded DNA at the promoter region of the template strand and initiate the process of transcription. RNA polymerase moves along the
DNA and leads to the unwinding of DNA duplex into two separate strands. Then, one of the strands, called sense strand, acts as template for mRNA synthesis. The enzyme, RNA polymerase, utilizes nucleoside triphosphates (dNTPs) as raw material and polymerizes them to form mRNA according to the complementary bases present on the template DNA. This process of opening of helix and elongation of polynucleotide chain continues until the enzyme reaches the terminator region. As RNA polymerase reaches the terminator region, the newly synthesized mRNA transcripted along with enzyme is released. Another factor called terminator factor ( $\tilde{A} \hat{A})$ is required for the termination of the transcription.
(b) Polymorphism
Polymorphism is a form of genetic variation in which distinct nucleotide sequence can exist at a particular site in a DNA molecule. This heritable mutation is observed at a high frequency in a population. It arises due to mutation either in somatic cell or in the germ cells. The germ cell mutation can be transmitted from parents to their offsprings. This results in accumulation of various mutations in a population, leading to variation and polymorphism in the population. This plays a very important role in the process of evolution and speciation.
(c) Translation
Translation is the process of polymerizing amino acid to form a polypeptide chain. The triplet sequence of base pairs in mRNA defines the order and sequence of amino acids in a polypeptide chain.
The process of translation involves three steps.
(i) Initiation
(ii) Elongation
(iii) Termination
During the initiation of the translation, tRNA gets charged when the amino acid binds to it using ATP. The start (initiation) codon (AUG) present on mRNA is recognized only by the charged tRNA. The ribosome acts as an actual site for the process of translation and contains two separate sites in a large subunit for the attachment of subsequent amino acids. The small subunit of ribosome binds to mRNA at the initiation codon (AUG) followed by the large subunit. Then, it initiates the process of translation. During the elongation process, the ribosome moves one codon downstream along with mRNA so as to leave the space for binding of another charged tRNA. The amino acid brought by tRNA gets linked with the previous amino acid through a peptide bond and this process continues resulting in the formation of a polypeptide chain. When the ribosome reaches one or more STOP codon (VAA, UAG, and UGA), the process of translation gets terminated. The polypeptide chain is released and the ribosomes get detached from mRNA.
Translation of proteins
(d) Bioinformatics
Bioinformatics is the application of computational and statistical techniques to the field of molecular biology. It solves the practical problems arising from the management and analysis of biological data. The field of bioinformatics developed after the completion of human genome project (HGP). This is because enormous amount of data has been generated during the process of HGP that has to be managed and stored for easy access and interpretation for future use by various scientists. Hence, bioinformatics involves the creation of biological databases that store the vast information of biology.
It develops certain tools for easy and efficient access to the information and its utilization. Bioinformatics has developed new algorithms and statistical methods to find out the relationship between the data, to predict protein structure and their functions, and to cluster the protein sequences into their related families.
पिछले अध्याय में आपने वंशागति प्रतिरूपों के आनुवंशिक आधार के बारे में पढ़ा हैं। मेंडल के नियमों के प्रतिपादन तक वे कारक जो वंशागति के प्रतिरूप को नियंत्रित करते हैं, उनके बारे में कोई जानकारी नहीं थी। सौ वर्षों बाद अनुमानित आनुवंशिक पदार्थ का पता चल पाया। अधिकतर जीवों में यह आनुवंशिक पदार्थ डीएनए डीआक्सीराइबो-न्यूक्लिक अम्ल था। कक्षा 11 में आप पढ़ चुके हैं कि न्यूक्लिक अम्ल न्यूक्लिओटाइड का बहुलक है।
सजीवों में दो प्रकार के न्यूक्लिक अम्ल मिलते हैं डीआक्सीराइबोन्यूक्लिक अम्ल (डीएनए) व राइबोन्यूक्लिक अम्ल (आरएनए) अधिकतर जीवों में आनुवंशिक पदार्थ डीएनए होता है। कुछ विषाणुओं में आरएनए आनुवंशिक पदार्थ के रूप में मिलता है, लेकिन यह अधिकतर वाहक के रूप में कार्य करता है। आरएनए के अन्य और भी अतिरिक्त कार्य हैं। यह अनुकूलक, सरंचनात्मक व कुछ स्थितियों में उत्प्रेरक अणु का कार्य करता है। न्यूक्लिओटाइड्स की सरंचना व एकल ईकाईयों से जुड़कर न्यूक्लिक अम्ल बहुलक बनने के बारे में आप पहले ही कक्षा 11 में पढ़ चुके हैं। इस अध्याय में डीएनए की संरचना, इसकी प्रतिकृति, डीएनए से आरएनए के निर्माण की विधि (अनुलेखन), आनुवंशिक कूट (कोड) जो प्रोटीन्स में अमीनो अम्लों के क्रम को निर्धारित करते हैं प्रोटीन संश्लेषण (स्थानांतरण) प्रक्रिया व इनके नियंत्रण के प्रारंभिक आधार के बारे में पढ़ंगे। पिछले दशक में मानव जीनोम में स्थित पूर्ण न्यूक्लियोराइड्स क्रमों के निर्धारण से जीनोमीक्स के नए महाकल्प को आरंभ हुआ। इस अध्याय के अंतिम खंड में मानव जीनोम अनुक्रम की आवश्यक पहलुओं एवं इसके परिणामों के बारे में वर्णन किया जाएगा।
अपनी चर्चा की शुरुआत सबसे पहले सजीवों में मिलने वाले सर्वाधिक रुचिकर अणु डीएनए की संरचना के अध्ययन से करें। आगे के खंडों में इस बात को समझने का प्रयास करेंगे कि यह बहुतायत से मिलने वाला आनुवंशिक पदार्थ क्यों है व इसका आएएनए के साथ क्या संबंध है।
5.1 डीएनए
डीएनए-डीआक्सीराइबोन्यूक्लिओटाइड्स का एक लंबा बहुलक है- डीएनए की लंबाई सामान्यतया इसमें मिलने वाले न्यूक्लियोटाइड्स (न्यूक्लियोटाइड्स युग्म का संबंध क्षार युग्म से है) पर निर्भर है। यह किसी भी जीव की विशेषता है। उदाहरणार्थ - एक जीवाणुभोजी जिसे $\phi \times 174$ कहते हैं इसमें 5386 न्यूक्लिओटाइडस मिले हैं, जीवाणुभोजी लैंड्डा में 48502 क्षार युग्म, इस्चेरिचिया कोलाई में $4.6 \times 10^{6}$ क्षार युग्म व मनुष्य के अगुणित डीएनए में $3.3 \times 10^{9}$ क्षार युग्म है। अब इस लंबे बहुलक की संरचना का वर्णन करेंगे।
5.1.1 पॉलीन्यूक्लियोटाइड श्रृंखला की संरचना
पॉलीन्यूक्लियोटाइड शृंखला (डीएनए या आरएनए) की रासायनिक संरचना संक्षेप में निम्न है। न्यूक्लियोटाइड के तीन घटक होते हैं - नाइट्रोजनी क्षार, पेंटोस शर्करा (आरएनए के मामले में रिबोस तथा डीएनए में डीऑक्सीरिबोज) और एक फॉस्फेट ग्रुप। नाइट्रोजनी क्षार दो प्रकार के होते है - प्यूरीन्स (एडेनीन व ग्वानीन) व पायरिमिडीन (साइटोसीन, यूरेसिल व थाइमीन)। साइटोसीन डीएनए व आरएनए दोनों में मिलता है जबकि थाइमीन डीएनए में मिलता है। थाइमीन के स्थान पर यूरेसील आरएनए में मिलता है। नाइट्रोजनी क्षार नाइट्रोजन ग्लाइकोसिडिक बंध द्वारा पेंटोस शर्करा $1^{\prime} \mathrm{C}$ हाइड्रॉक्सिल $(\mathrm{OH})$ से जुड़कर न्यूक्लियोसाइड बनाता है जैसे - एडीनोसीन या डीऑक्सी एडीनोसीन, ग्वानोसीन या डीऑक्सी ग्वानोलीन, साइटीडीन या डीऑक्सीसाइटीडीन व यूरीडीन या डीऑक्सी थाइमीडीन। जब फॉस्फेट समूह फॉस्फोएस्टर बंध द्वारा न्यूक्लीयोसाइड के $5^{4} \mathrm{C}$ के हाइड्रॉक्सील समूह से जुड़ जाता है तब संबंधित न्यूक्लियोटाइड्स (डीऑक्सी न्यूक्लियोटाइड्स उपस्थित शर्करा के प्रकार पर निर्भर है) का निर्माण होता है। दो -न्यूक्लियोटाइड्स $3^{\prime}-5^{\prime}$ फॉस्फोडाइस्टर बंध द्वारा जुड़कर डाईन्यूक्लियोटाइड का निर्माण करता है। इस तरह से कई न्यूक्लियोटाइड्स जुड़कर एक पॉलीन्यूक्लियोटाइड्स शृंखला का निर्माण करते हैं। इस तरह से निर्मित बहुलक के राइबोज शर्करा के $5^{4}$ किनारे पर स्वतंत्र फॉस्फेट समूह मिलता है जिसे पॉलीन्यूक्लियोटाइडशृंखला का $5^{4}$ किनारा कहते हैं। ठीक इसी तरह से बहुलक के दूसरे किनारे पर शर्करा मुक्त $3^{t}$ - हाइड्रॉक्सिल समूह से जुड़ा होता है। पॉलीन्यूक्लियोटाइड श्रृंखला का $3^{4}$ किनारा कहते हैं। पॉलीन्यूक्लियोटाइड श्रृंखला के आधार का निर्माण शर्करा व फॉस्फेट्स से होता है। नाइट्रोजनी क्षार शर्करा अंश से जुड़ा होता है जो आधार से प्रक्षेपित होता है (चित्र 5.1)।
चित्र 5.1 एक पालीन्यूक्लियोटाइड शृंखला
आरएनए में प्रत्येक न्यूक्लियोटाइड अवशेष के राइबोज की $2^{6}$ जगह पर एक अतिरिक्त हाइड्रॉक्सील समूह स्थित होता है। आरएनए में थाइमीन ( $5^{4}$-मथिल यूरेसील थाइमीन का दूसरा रासायनिक नाम है) की जगह पर यूरेसील मिलता है।
फ्रेडरीच मेस्चर ने 1869 में केंद्रक में मिलने वाले अम्लीय पदार्थ डीएनए की खोज की थी। उसने इसका नाम ‘न्यूक्लिन’ दिया। ऐसे लंबे संपूर्ण बहुलक को तकनीकी कमियों के कारण विलगित करना कठिन था, इस कारण से बहुत लंबे समय तक डीएनए की संरचना के बारे में स्पष्ट जानकारी नहीं थी। मौरिस विल्किन्स व रोजलिंड फ्रैंकलिन द्वारा दिए गए एक्स-रे निवर्तन आंकड़े के आधार पर 1953 में जेम्स वाट्सन व फ्राँन्सिस क्रीक ने डीएनए की संरचना का द्विकुंडली नमूना प्रस्तुत किया। उनके प्रस्तावों में पॉलीन्यूक्लियोटाइड भृंखलाओं के दो लड़ियों के बीच क्षार युग्मन की उपस्थिति एक बहुत प्रमाणित शृंखला (चेन) थी। उपरोक्त प्रस्ताव द्विकुंडली डीएनए के इर्विन चारगाफ़ के परीक्षण के आधार पर भी था जिसमें इसने बताया कि एडनिन व थाइमिन तथा ग्वानिन व साइटोसीन के बीच अनुपात स्थित व एक दूसरे के बराबर रहता है।
क्षार युग्मन पॉलीन्यूक्लियोटाइड शृंखलाओं की एक खास विशेषता है। ये शृंखलाएँ एक दूसरे के पूरक है इसलिए एक रज्जुक में स्थित क्षार क्रमों के बारे जानकारी होने पर दूसरी रज्जुक के क्षार क्रमों की कल्पना कर सकते हैं। यदि डीएनए (इसे पैतृक डीएनए कहते हैं) की प्रत्येक रज्जुक नए रज्जुक के संश्लेषण हेतु टेम्पलेट का कार्य करते हैं। इस तरह से दो द्विरज्जुकीय डीएनए (जिसे संतति डीएनए कहते हैं) का निर्माण होता है जो पैतृक डीएनए अणु के समान होते हैं। इस कारण से आनुवंशिक डीएनए की संरचना के बारे में बहुत स्पष्ट जानकारी मिल सकी।
द्विकुंडली डीएनए की संरचना की खास विशेषताएँ निम्न हैं -
(क) यह दो पॉलीन्यूक्लियोटाइड श्रृंखलाओं का बना होता है जिसका आधार शर्करा-फॉस्फेट का बना होता है व क्षार भीतर की ओर प्रक्षेपी होता है।
(ख) दोनों भृंखलाएँ प्रति समानांतर ध्रुवणता रखती है। इसका मतलब एक शृंखला को ध्रुवणता $5^{\natural}$ से $3^{\natural}$ की ओर हो तो दूसरे की ध्रुवणता $3^{\natural}$ से $5^{\natural}$ की तरह होगी।
(ग) दोनों रज्जुकों के क्षार आपस में हाइड्रोजन बंध द्वारा युग्मित होकर क्षार युग्मक बनाते हैं। एडेनिन व थाइमिन जो विपरीत रज्जुकों में होते हैं। आपस में दो हाइड्रोजन बंध बनाते हैं। ठीक इसी तरह से ग्वानीन साइटोसलीन से तीन-हाइड्रोजन बंध द्वारा बँधा रहता है जिसके फलस्वरूप सदैव यूरीन के विपरीत दिशा में पीरीमिडन होता है। इससे कुंडली के दोनों रज्जुकों के बीच लगभग समान दूरी बनी रहती है (चित्र 5.2)।
चित्र 5.2 द्विरज्जुकीय पॉलीन्युक्लियोटाइड शृंखला
(घ) दोनों श्रृंखलाएँ दक्षिणवर्ती कुंडलित होती हैं। कुंडली का पिच 3.4 नैनोमीटर (एक नैनोमीटर एक मीटर का 10 करोड़वाँ भाग होता है वह $10^{-9}$ मीटर के बराबर है) व प्रत्येक घुमाव में लगभग 10 क्षार युग्मक मिलते हैं। परिणामस्वरूप एक कुंडली में एक क्षार युग्मक के बीच लगभग 0.34 नैनोमीटर की दूरी होती है।
(ङ) द्विकुंडली में एक क्षार युग्म की सतह के ऊपर दूसरे स्थित होते हैं। इसके अतिरिक्त हाइड्रोजन बंध कुंडलिनी संरचना को स्थायित्व प्रदान करते हैं।
चित्र 5.3 द्विकुंडली डीएनए
प्यूरीन व पीरिमीडीन की संरचनात्मक तुलना करो। क्या आप बता सकते हैं कि चित्र 5.3 द्विकुंडली डीएनए डीएनए में दो पॉलीन्यूक्लियोटाइड श्रृंखलाओं के बीच की दूरी हमेशा लगभग समान क्यों रहती है? (चित्र 5.3)।
डीएनए की द्विकुंडली संरचना का प्रस्ताव यू परिक्रमी है कि आनुवांशिक उलझाव को सरल तरीके से व्याख्या करने में सक्षम है। शीघ्र ही आणविक जीव विज्ञान में फ्रांसिस क्रिक ने मूल सिद्धांत (सेंट्रल डोग्मा) का विचार प्रस्तुत किया जिससे स्पष्ट है कि आनुवांशिक सूचनाओं का बहाव डीएनए से आरएनए व इससे प्रोटीन की तरह रहता है (डीएनए $\rightarrow$ आरएनए $\rightarrow$ प्रोटीन)।
कुछ विषाणुओं में उपरोक्त बहाव विपरीत दिशा आरएनए से डीएनए की तरफ भी होता है। क्या तुम इस प्रक्रम के लिए एक साधारण नाम का सुझाव कर सकते हो?
5.1.2 डीएनए कुंडली का पैकेजिंग
लगातार दो क्षार युग्मों के बीच की दूरी 0.34 नैनोमीटर $\left(0.34 \times 10^{-9}\right.$ मीटर $)$ मान ली जाए और यदि एक प्रारूपी स्तनधारी कोशिका में डीएनए द्विकुंडली की लंबाई की गणना चित्र 5.4 अ न्यूक्लियोसोम (साधारणतया सभी क्षार युग्म की संख्या को लगातार दो क्षार युग्म के बीच की दूरी से गुणा करने पर दूरी की गणना कर सकते हैं, वह है $6.6 \times 10^{9}$ क्षार युग्म $\times 0.34 \times 10^{-9}$ मीटर प्रति क्षार युग्म) की जाए तो यह लगभग 2.2 मीटर के बराबर होगी। यह लंबाई प्रारूपी केंद्रक की लंबाई-चौड़ाई (लगभग $10^{-6}$ मीटर) से काफी अधिक है इस तरह एक लंबा बहुलक एक कोशिका में कैसे पेकेज्ड होता है?
यदि ई.कोलाई डीएनए की लंबाई 1.36 मिलीमीटर है तो क्या आप ई.कोलाई में क्षार युग्मों की संख्या की गणना कर सकते हैं?
असीमकेंद्रकी जैसी ई.कोलाई जिसमें स्पष्ट केंद्रक नहीं मिलता है इसके बावजूद भी डीएनए पूरी कोशिका में नहीं फैला होता है। डीएनए (ऋणात्मक आवेशित) कुछ प्रोटीन्स (धनात्मक आवेशित) से बँधकर एक जगह पर स्थित होते हैं जिसे केंद्रकाभ (न्यूक्लिआएड) कहते हैं। न्यूक्लीआएड में डीएनए बड़े लूपों में व्यवस्थित होता है जो प्रोटीन से जुड़े होते हैं।
चित्र 5.4 अ न्यूक्लियोसोम
चित्र 5.4 ब ई एम दृश्य ‘डोरी पर बीड्स’
ससीमकेंद्रकी/सुकेंद्रकी में यह संरचना और काफी जटिल होती है। धनात्मक आवेशित क्षारीय प्रोटीन का समूह होता है जिसे हिस्टोन्स कहते हैं। इस प्रोटीन्स का आवेश, आवेशित पार्श्व शृंखलाओं में स्थित एमीनो अम्लों की बहुलता पर निर्भर करता है। हिस्टोन्स में क्षारीय एमीनो अम्लीय लाइसीन व आरजीनीन अधिक मात्रा में मिलते हैं। दोनों एमीनो अम्ल की पार्श्व श्रृंखलाओं पर धनात्मक आवेश होता है। हिस्टोन व्यवस्थित होकर आठ हिस्टोन अणुओं की एक ईकाई बनाता है जिसे हिस्टोन अष्टक कहते हैं।
धनात्मक आवेशित हिस्टोन अष्टक चारो तरफ से ऋणात्मक आवेशित डीएनए से सटा होता है जिसे न्यूक्लियोसोम कहते हैं (चित्र 5.4अ)। एक प्रारूपी न्यूक्लियोसोम 200 क्षार युग्म की डीएनए कुंडली होती है। केंद्रक में मिलने वाली एक संरचना जिस पर न्यूक्लियोसोम्स एक के बाद एक मिलते है उसे क्रोमेटीन कहते हैं - जो केंद्रक में अभिरंजित धागे की तरह की संरचना होती है। इलेक्ट्रॉन सूक्ष्मदर्शी द्वारा देखने पर न्यूक्लियोसोम्स क्रोमेटीन जिस तरह से ‘डोरी पर बीड्स’ की तरह से दिखाई पड़ते हैं (चित्र 5.4ब)।
सैद्धांतिक रूप से तुम सोच सकते हो कि एक स्तनधारी कोशिका में ऐसे दाने (न्यूक्लियोसोम) की तरह की रचना की संख्या क्या हो सकती है?
डोरी पर बीड्स सदृश संरचना क्रोमेटीन में कोष्ठित होकर क्रोमेटीन धागों (सूत्रों) का निर्माण करती है जो आगे कुंडलित व संघनित होकर कोशिका विभाजन की मध्यावस्था में गुणसूत्र का निर्माण करते हैं। उच्च स्तर पर क्रोमेटीन के पेकेजिंग हेतु अतिरिक्त प्रोटीन की आवश्यकता होती है जिसे सामूहिक रूप से गैर-हिस्टोन गुणसूत्रीय प्रोटीन ( नान-हिस्टोन क्रोमोसोमल प्रोटीन, एन एस सी) कहते हैं। एक प्रारूपी केंद्रक में कुछ जगहों पर क्रोमेटीन ढीले-ढाले बँधे (हल्के अभिरंजित) होते हैं जिसे ‘यूक्रोमेटीन’ कहते हैं। क्रोमेटीन जो काफी अच्छे ढंग से बँधे होते हैं व गाढ़े रंग के दिखायी पड़ते हैं उसे ‘हेटोरोक्रोमेटीन’ कहते हैं।
5.2 आनुवंशिक पदार्थ की खोज
मेस्चर द्वारा न्यूक्लिन व मेंडल के वंशागति सिद्धांतों तथा एक लंबे समय के बाद यह सिद्ध व ज्ञात हो सका कि डीएनए आनुवंशिक पदार्थ के रूप में कार्य करता है। आनुवंशिक वंशागति के आणविक आधार की खोज 1926 में हुई। ग्रेगर मेंडल, वाल्टर सटन, थामस हंट मार्गन व अन्य दूसरे वैज्ञानिकों की पूर्व खोजों के आधार पर स्पष्ट हो गया कि गुणसूत्र अधिकतम कोशिकाओं के केंद्रक से मिलता है। लेकिन इस प्रश्न का उत्तर नहीं मिल सका कि कौन-सा अणु वास्तव में आनुवंशिक पदार्थ है।
रूपांतरीय सिद्धांत - वर्ष 1928 में फ्रेडेरिक ग्रिफीथ ने स्ट्रेप्टोकोकस नीमोनी (जीवाणु जो निमोनिया के लिए जिम्मेदार है) के साथ कई प्रयोगों से रूपांतरण की अच्छे ढंग से व्याख्या थी। उनके प्रयोगों के दौरान एक सजीव जीव (जीवाणु) के प्राकृतिक रूप में परिवर्तन हो गया।
जब स्ट्रेप्टोकोकस नीमोनी (न्यूमोकोकस) जीवाणु की संवर्धन प्लेट पर वृद्धि करता है तब इसकी कुछ चिकनी चमकीली कालोनी $(\mathrm{S})$ व दूसरी सक्ष कालोनी $(\mathrm{R})$ का निर्माण होता है। यह एस प्रभेद के जीवाणु में श्लेष्मा (बहुशर्कराइड) युक्त आवरण होता है जबकि आर $(\mathrm{R})$ प्रभेद में यह आवरण नहीं होता है। एस प्रभेद (उग्र) से संक्रमित चूहे नीमोनिया संक्रमण से मर जाते हैं, जबकि आर प्रभेद द्वारा नीमोनिया नहीं होता है।
एस प्रभेद $\longrightarrow$ चूहे में प्रवेश कराया गया $\longrightarrow$ चूहा मर जाता है
आर प्रभेद $\longrightarrow$ चूहे में प्रवेश कराया गया $\longrightarrow$ चूहा जीवित रहता है
ग्रीफिथ ने जीवाणु को गर्म करने पर उन्हें मृत पाया। उसने पाया कि गर्म करने पर मृत एस प्रभेद जीवाणु को चूहे में प्रवेश कराने से उसकी मृत्यु नहीं हो पायी। लेकिन जब उसमें गर्म करने से मृत एस व सजीव आर जीवाणु के मिश्रण को चूहे में प्रवेश कराया तब चूहे की मृत्यु हो गयी। इस मृत चूहे से उसने सजीव एस जीवाणु को विलगित किया। ग्रीफिथ ने बताया कि आर-प्रभेद जीवाणु ताप मृत एस-प्रभेद जीवाणु द्वारा रूपांतरित किए गए। यह रूपांतरित कारक ताप मृत एस-प्रभेद से आर-प्रभेद में स्थानांतरित होने से इसमें चिकनी बहुशर्कराइड आवरण का निर्माण होता है जिससे यह उग्र रूप में परिवर्तन हो जाता है। यह निश्चित ही आनुवंशिक पदार्थ के स्थानांतरण के कारण हो पाता है। इन प्रयोगों से आनुवंशिक पदार्थ के जीव रासायनिक प्रकृति के बारे में नहीं बताया जा सकता है।
रूपांतरित सिद्धांत के जीव रासायनिक लक्षण - ओसवाल्ड एबेरी, कोलीन मैकलिओड व मैक्लीन मैककार्टी (1933-44) के कार्य के पहले ऐसा समझा जाता था कि आनुवंशिक पदार्थ प्रोटीन है। ग्रीफिथ के सभी प्रयोगों के आधार पर रूपांतरित सिद्धांत की जीव रासायनिक प्रकृति के बारे में पता चला।
ताप मृत एस कोशिकाओं से जैव रासायनों (प्रोटीन, डीएनए, आरएनए आदि) को अलग कर यह पता लगाने के किए शोधित किया कि इनमें से कौन आर कोशिका को एस कोशिका में रूपांतरित करने में सहायक होता है। उन्होंने इस बात का पता लगाया कि एस जीवाणु का केवल डीएनए ही आर जीवाणु को रूपांतरित कर सकता है।
उन्होंने इस बात का भी पता लगाया कि प्रोटीन पाचक एंजाइम (प्रोटीएजिज) व आरएनए पाचक एंजाइम (आरएनेज) इस रूपांतरण को प्रभावित नहीं करते हैं, इसलिए रूपांतरित पदार्थ प्रोटीन या आरएनए नहीं है। डीएनएज से पाचन के बाद रूपांतरण प्रक्रिया बंद हो जाती है। इससे स्पष्ट है कि डीएनए ही रूपांतरण के लिए जिम्मेदार है। इससे उन्होंने निष्कर्ष निकाला कि आनुवंशिक पदार्थ डीएनए है, लेकिन इस बात से सभी जीव विज्ञानी सहमत नहीं थे।
डीएनएएस (DNAs) व डीएनेज (DNase) के बीच क्या कोई अंतर है?
5.2.1 आनुवंशिक पदार्थ डीएनए है
डीएनए आनुवंशिक पदार्थ है इसके बारे में सुस्पष्ट प्रमाण अल्फ्रेड हर्षे व मार्था चेस (1952) के प्रयोगों से प्राप्त हुआ। इन्होंने उन विषाणुओं पर कार्य किया जो जीवाणु को संक्रमित करते हैं जिसे जीवाणुभोजी कहते हैं।
जीवाणुभोजी जीवाणु से चिपकते हैं अपने आनुवंशिक पदार्थ को जीवाणु कोशिका में भेजते हैं। जीवाणु कोशिका विषाणु के आनुवंशिक पदार्थ को अपना समझने लगते हैं जिससे आगे चलकर अधिक विषाणुओं का निर्माण होता है। हर्षे व चेस ने इस बात का पता लगाने के लिए प्रयोग किया कि विषाणु से प्रोटीन या डीएनए निकल कर जीवाणु में प्रवेश करता है।
उन्होंने कुछ विषाणुओं को ऐसे माध्यम पर पैदा किया जिसमें एक को विकिरण सक्रिय फॉस्फोरस व दूसरे विषाणुओं को विकिरण सक्रिय सल्फर पर वृद्धि किया था। जिस विषाणु को विकिरण सक्रिय फॉस्फोरस की उपस्थिति में पैदा किया। उसमें विकिरण सक्रिय डीएनए पाया गया जबकि विकिरण सक्रिय प्रोटीन नहीं था, क्योंकि डीएनए में फॉस्फोरस होता है; प्रोटीन नहीं। ठीक इसी तरह से विषाणु जिसे विकरण सक्रिय सल्फर की उपस्थिति में पैदा किया गया उनमें विकिरण सक्रिय प्रोटीन पाई गई, डीएनए विकिरण सक्रिय नहीं था; क्योंकि डीएनए में सल्फर नहीं मिलता है।
विकरण सक्रिय जीवाणु भोजी ई.कोलाई जीवाणु से चिपक जाते हैं। जैसे संक्रमण आगे बढ़ता है जीवाणु को संमिश्रक में हिलाने से विषाणु आवरण अलग हो जाता है। जीवाणुओं को अपकेंद्रणयंत्र में प्रचक्रण कराने से विषाणु कण जीवाणुओं से अलग हो जाते हैं।
जो जीवाणु विकिरण सक्रिय डीएनए रखने वाले विषाणु से संक्रमित हुए थे, वे विकिरण सक्रिय रहे। इससे स्पष्ट है कि जो पदार्थ विषाणु से जीवाणु में प्रवेश करता है, वह डीएनए है। जो जीवाणु उन विषाणुओं से संक्रमित थे जिनमें विकिरण सक्रिय प्रोटीन था, वे विकिरण सक्रिय नहीं हुए। इससे संकेत मिलता है कि प्रोटीन विषाणु से जीवाणु में प्रवेश नहीं करता है। इस कारण से आनुवंशिक पदार्थ डीएनए ही है जो विषाणु से जीवाणु में जाता है (चित्र 5.5 )।
चित्र 5.5 हर्षे-चेस का प्रयोग
5.2.2 आनुवंशिक पदार्थ के गुण ( डीएनए बनाम आरएनए)
पिछली चर्चाओं से यह स्पष्ट है कि प्रोटीन बनाम डीएनए के बीच जो विवाद आनुवंशिक पदार्थ को लेकर था वह अब स्पष्ट रूप से हर्षे व चेस के प्रयोग से सुलझ चुका है। अब यह सर्वमान्य हो चुका है कि डीएनए आनुवंशिक पदार्थ के रूप में कार्य करता है। फिर भी यह स्पष्ट हो गया कि कुछ विषाणुओं में आरएनए (उदाहरण -टोबैको मोज़ेक वाइरस, क्यूबीटा बैक्टिरीयोफेज आदि) आनुवंशिक पदार्थ है। कुछ प्रश्नों के उत्तर आपको देने हैं जैसे - क्यों डीएनए प्रमुख आनुवंशिक पदार्थ है, जबकि आरएनए दूत व अनुकूलन जैसे सक्रिय कार्य करता है, दोनों न्यूक्लिक अम्ल अणुओं की रासायनिक संरचना में अंतर बताइए।
क्या आप डीएनए व आरएनए के बीच दो रासायनिक अंतरों को बता सकते हो?
एक अणु जो आनुवंशिक पदार्थ के रूप में कार्य कर सकता है वह निम्न मानदंडों को अवश्य पूर्ण करता है-
(क) यह अपना प्रतिकृति बनाने में सक्षम है (प्रतिकृति)
(ख) इसे संरचना व रासायनिक संगठन के आधार पर स्थिर होना चाहिए।
(ग) इनमें धीमें परिवर्तनों (उत्परिवर्तन) की संभावना होती है जो विकास के लिए आवश्यक है।
(घ) इसे स्वयं ‘मेंडल के लक्षण’ के अनुरूप अभिव्यक्त होना चाहिए।
यदि कोई क्षार युग्मन पूरकता के सिद्धांत को ध्यान में रखते हुए परीक्षण करता है, तब वह पाएगा कि दोनों न्यूक्लिक अम्लों (डीएनए व आरएनए) में स्वयं प्रतिकृति की क्षमता होती है। सजीव तंत्र के अन्य अणुओं में जैसे - प्रोटीन स्वयं प्रथम मापदंड को पूर्ण करने में असफल है।
आनुवंशिक पदार्थ इतना स्थायी होना चाहिए कि जीवन चक्र की विभिन्न अवस्थाओं, उम्र या जीव की शरीरक्रिया में परिवर्तन से इसमें परिवर्तन नहीं होना चाहिए। आनुवंशिक पदार्थ का स्थायित्व उसकी एक प्रमुख विशेषता है जो ग्रिफिथ के ‘रूपांतरित कारक’ से स्पष्ट है जिसमें ताप से जीवाणु की मृत्यु हो जाती है, लेकिन आनुवंशिक पदार्थ की कुछ विशेषताएँ नष्ट नहीं हो पाती हैं। डीएनए के परिपेक्ष में इस बात को और अच्छे ढंग से समझ सकते हैं कि डीएनए की दोनों रज्जुक एक दूसरे के पूरक होते हैं जो गर्म करने पर एक दूसरे से अलग हो जाते हैं; लेकिन पुनः उचित स्थिति के आने पर एक दूसरे से जुड़ जाते हैं। आरएनए के प्रत्येक न्यूक्लियोटाइड पर $2^{4}$-हाइड्रॉक्सिल समूह मिलता है यह क्रियाशील समूह है जिससे आरएनए अस्थिर व आसानी से विखंडित हो जाता है। इस कारण से डीएनए रासायनिक संगठन की दृष्टि से कम सक्रिय व संरचनात्मक दृष्टि में अधिक स्थायी होता है। इस कारण दोनों न्यूक्लिक अम्लों में डीएनए एक अच्छा आनुवंशिक पदार्थ माना गया है।
वास्तव में डीएनए में यूरेसील की जगह थाइमिन होने से उनमें एक अधिक स्थायत्त्व मिलता है। (इसके बारे में विस्तृत चर्चा हेतु हमें डीएनए में होने वाले मरम्मत की प्रक्रिया को समझना होगा, और आप इस प्रक्रिया के बारे में उच्च कक्षाओं में अध्ययन करेंगे।)
दोनों आरएनए व डीएनए उत्परिवर्तित हो सकते हैं। वास्तव में आरएनए अस्थायी व तीव्र गति से उत्परिवर्तित होता है। परिणामस्वरूप, विषाणुओं में आरएनए जीनोम मिलता है उसकी जीवन अवधि छोटी व तेजी से उत्परिवर्तित व विकसित होने वाली होती है।
आरएनए प्रोटीन संश्लेषण के लिए सीधे कूटलेखन करते हैं, इसलिए वे आसानी से लक्षण व्यक्त करते हैं। डीएनए प्रोटीन संश्लेषण के लिए आरएनए पर निर्भर है। प्रोटीन संश्लेषण की सारी व्यवस्था आरएनए से विकसित हुई। उपरोक्त चर्चाओं से स्पष्ट है कि दोनों डीएनए व आरएनए आनुवंशिक पदार्थ के रूप में कार्य करते हैं। डीएनए के अधिक स्थायी होने से वह आनुवंशिक सूचनाओं के संचय हेतु सबसे उपयोगी है, आनुवंशिक सूचनाओं के स्थानांतरण हेतु आरएनए उपयुक्त है।
5.3 आरएनए संसार
पूर्ववर्त्ती चर्चाओं से तत्काल एक प्रश्न उठता है कि प्रथम आनुवंशिक पदार्थ कौन सा है? इस अध्याय में रासायनिक विकास के बारे में विस्तृत रूप से वर्णन किया जाएगा; लेकिन संक्षेप में कुछ तथ्यों व बिंदुओं को हम अवश्य उजागर करेंगे।
आरएनए पहला आनुवंशिक पदार्थ था। अब बहुत पर्याप्त प्रमाण है कि जीवन के आवश्यक प्रक्रमों (जैसे-उपापचयी, स्थानांतरण, संबंधन आदि) का विकास आरएनए से हुआ। आरएनए आनुवंशिक पदार्थ के साथ एक उत्प्रेरक (जैविक तंत्र में कुछ ऐसी महत्त्वपूर्ण जैव रासायनिक अभिक्रियाएँ हैं जो आरएनए उत्प्रेरक द्वारा उत्प्रेरित की जाती है प्रोटीन एंजाइम का इसमें कोई योगदान नहीं है।) आरएनए उत्प्रेरक के रूप में क्रियाशील लेकिन अस्थायी है। इस कारण से आरएनए के रासायनिक रूपांतरण से डीएनए का विकास हुआ, जिससे यह अधिक स्थायी है। डीएनए के द्विरज्जुकों व पूरक रज्जुकों के कारण तथा इनमें मरम्मत प्रक्रियाओं के विकास से अपने में होने वाले परिवर्तनों के प्रति प्रतिरोधी है।
5.4 प्रतिकृति
डीएनए के द्विकुंडली रचना के प्रतिवादन के साथ ही वॉटसन व क्रिक ने तत्काल डीएनए की प्रतिकृति की योजना प्रस्तुत की। यदि उनके मूल कथनों को उद्धृत किया जाए तो वह इस प्रकार हैं-
चित्र 5.6 डी एन ए के अर्धसंरक्षी प्रकृतियन का वाटसन-क्रिक प्रतिरूप
“विशिष्ट युग्मन की जानकारी के बाद आनुवंशिक पदार्थ के नए रूप के निर्माण की प्रक्रियाओं के बारे में तत्काल प्रतिपादन करने से बचा नहीं जा सकता था।” (वाटसन व क्रिक, 1953)
उपरोक्त योजना से स्पष्ट है कि दोनों रज्जुक अलग होकर टेम्पलेट के रूप में कार्यकर नए पूरक रज्जुकों का निर्माण करते हैं। प्रतिकृति के पूर्ण होने के बाद जो डीएनए अणु बनता है उसमें एक पैतृक व एक नई निर्मित लड़ी रज्जुक होती है। डीएनए प्रतिकृति की यह योजना अर्धसरंक्षी (सेमीकंजरवेटिव) कहलाती है (चित्र 5.6)।
5.4.1 प्रायोगिक प्रमाण
अब यह सिद्ध हो चुका है कि डीएनए का अर्धसरंक्षी प्रतिकृतियन होता है। इसके बारे में सर्वप्रथम जानकारी इस्चेरिचिया कोलाई से प्राप्त हुई और आगे जाकर उच्च जीवों जैसे पौधों व मानव कोशिकाओं में पता लग पाया। मैथ्यूमेसेल्सन व फ्रैंकलिन स्टाल ने 1958 में निम्न प्रयोग किया -
(क) इन्होंने ई.कोलाई को ऐसे संवर्धन में विकसित किया जिसमें ${ }^{15} \mathrm{NH}_{4} \mathrm{Cl}\left({ }^{15} \mathrm{~N}\right.$ नाइट्रोजन का भारी समस्थानिक है) अमोनिया क्लोराइड कई पीढ़ियों तक केवल नाइट्रोजन का स्त्रोत है। जिसके परिणामस्वरूप नवनिर्मित डीएनए एवं अन्य दूसरे नाइट्रोजन युक्त यौगिकों में ( ${ }^{15}$ नाइट्रोजन) ${ }^{15} \mathrm{~N}$ व्यवस्थित हो जाता है। इस भारी डीएनए अणु को सामान्य डीएनए से सोडियम क्लोराइड के घनत्व प्रवणता में अपकेंद्रीकरण करने से अलग कर सकते हैं। (कृपया ध्यान दें कि ${ }^{15}$ नाइट्रोजन एक विकिरण सक्रिय समस्थानिक नहीं है, और यह ${ }^{14}$ नाइट्रोजन $\left({ }^{14} \mathrm{~N}\right)$ से घनत्व के आधार पर अलग किया जा सकता है)।
(ख) इसके बाद कोशिकाओं को ऐसे संवर्धन में स्थानांतरित किया जिसमें साधारण ${ }^{14} \mathrm{NH}_{4} \mathrm{Cl}$ था व निश्चित समयांतराल पर गुणित कोशिकाओं के नमूनों को लेने पर व इससे डीएनए निष्कर्षण करने पर पाया कि यह हमेशा द्विरज्जुक कुंडलियों के रूप में मिलता है। डीएनए के घनत्वों के बारे में जानकारी प्राप्त करने हेतु विभिन्न नमूनों को स्वतंत्र रूप से सीजिएम $\mathrm{CSCl}$ ग्रेडिऐंट की प्रवणता पर अलग किया गया (चित्र 5.7)।
चित्र 5.7 मेसेल्सन एवं स्टाल का प्रयोग
क्या तुम अपकेंद्रबल के बारे में बता सकते हो? और सोचो क्यों एक अणु जो अधिक द्रव्यमान घनत्व का है तेजी से अवछाद बनाता है?
(ग) इस प्रकार, संवर्धन जिसको ${ }^{15} \mathrm{~N}$ से ${ }^{14} \mathrm{~N}$ माध्यम पर एक पीढ़ी तक स्थानांतरित किया गया था, इससे डीएनए निष्कर्षित करने पर पाया गया कि इसका घनत्व संकरित या मध्य था ( 20 मिनट बाद प्रथम पीढ़ी; ई.कोलाई 20 मिनट में विभाजित होता है)। डीएनए जो दूसरी पीढ़ी ( 40 मिनट बाद; द्वितीय पीढ़ी) के संवर्धन से निष्कर्षित किया गया कि समान मात्रा में संकरित डीएनए हल्के डीएनए से मिलकर बना होता है।
ई. कोलाई के 80 मिनट बाद वृद्धि से प्राप्त डीएनए में हल्के व संकरित डीएनए घनत्व का अनुपात होगा?
ठीक इसी तरह का प्रयोग टेलट व उनके सहयोगियों ने 1958 में विसिया फाबा (फाबा सेम) पर नवनिर्मित डीएनए का गुणसूत्र में वितरण का पता लगाने के लिए विकिरण सक्रिय थाइमीडिन का प्रयोग किया। इस प्रयोग से यह सिद्ध हो गया कि गुणसूत्र में डीएनए अर्ध संरक्षकीय तरह से प्रतिकृति करता है।
5.4.2 कार्यप्रणाली व एंजाइम
सजीव कोशिकाओं जैसे ई.कोलाई में प्रतिकृति हेतु उत्प्रेरकों (एंजाइम) के समूहों की आवश्यकता होती है। मुख्य एंजाइम जो डीएनए पर निर्भर है, वह डीएनए पॉलीमरेज है। यह डीएनए टेम्प्लेट का उपयोग डीऑक्सीन्युक्लियोराइड के बहुलकन को उत्प्रेरित करता है। यह एंजाइम काफी प्रभावी है, क्योंकि बहुत ही कम समय में अधिक संख्या में न्युक्लियाटाइडस के बहुलकन को उत्प्रेरित करता है। कल्पना करो कि ई. कोलाई में $4.6 \times 10^{6}$ क्षारयुग्मक मिलते हैं (इसकी तुलना मानव के द्विगुणित संख्या $6.6 \times 10^{9}$ क्षारयुग्मक से करो) जिनमें प्रतिकृति प्रक्रिया के पूर्ण होने में 18 मिनट लगते हैं। इसका मतलब बहुलीकरण की औसत दर लगभग 2000 क्षारयुग्मक प्रति सेकंड है। ये केवल बहुलीकरण को तेज नहीं करते, बल्कि अधिक शुद्धता के साथ अभिक्रिया को उत्प्रेरित भी करते हैं। प्रतिकृति में किसी भी तरह की गलती के परिणामस्वरूप उत्परिवर्तन होता है। इसके अतिरिक्त ऊर्जा की दृष्टि से प्रतिकृति एक महँगी प्रक्रिया है। अतः डीऑक्सीराइबोन्यूक्लियोसाइड ट्राइफॉस्फेट दोहरे उद्देश्य की पूर्ति करता है। इसके अतिरिक्त अवस्तर की तरह कार्य करते हुए बहुलीकरण अभिक्रिया के लिए ऊर्जा प्रदान करता है। (ATP की तरह डीऑक्सीन्यूक्लीओसाइड ट्राइफॉस्फेट में दो टरमिनल फॉस्फेट उच्च ऊर्जा वाले फॉस्फेट हैं)।
अधिक शुद्धता के साथ प्रतिकृति प्रक्रम को पूर्ण करने हेतु डीएनए पर निर्भर डीएनए पॉलीमरेज के साथ अन्य एंजाइम की आवश्यकता होती है। लंबे डीएनए अणुओं के दोनों रज्जुक एक साथ पृथक नहीं होते (क्योंकि इसके लिए अधिक ऊर्जा की आवश्यकता होती है), प्रतिकृति हेतु डीएनए कुंडलिनी छोटे-छोटे भाग में खुलते हैं जिसे प्रतिकृति द्विशाख कहते हैं। डीएनए पर निर्भर डीएनए पॉलीमरेज बहुलकन केवल एक दिशा $5^{4}$ से $3^{b}\left(5^{b} \rightarrow 3^{b}\right)$ की ओर उत्प्रेरित करता है। यह प्रतिकृति द्विशाख पर कुछ जटिलता पैदा करती है फलस्वरूप, ( $3^{b} \rightarrow 5^{b}$ ध्रुवता वाली टेम्प्लेट) की लड़ी पर प्रतिकृत सतत् होता रहता है जबकि दूसरी लड़ी $\left(3^{t} \rightarrow 5^{t}\right.$ ध्रुवता वाले टेम्प्लेट) पर यह असतत् होता है। तत्पश्चात यह असतत् रूप से संश्लेषित खंड एंजाइम डीएनए लाइगेज द्वारा आपस में जुड़ जाते हैं (चित्र 5.8)।
चित्र 5.8 प्रतिकृत द्विशाख
डीएनए पॉलीमरेज स्वयं प्रतिकृति प्रक्रम की शुरुआत नहीं कर सकते हैं। प्रतिकृति डीएनए के किसी भी जगह पर प्रतिकृति क्रमहीन प्रारंभ नहीं होती है। ई. कोलाई के डीएनए में कुछ निश्चित स्थान होते हैं। जहाँ से प्रतिकृति की शुरुआत होती है। इन जगहों को प्रतिकृति का स्थल नामकरण दिया गया है। इस कारण से प्रतिकृति की शुरुआत के लिए आवश्यक डीएनए खंडों की प्राप्ति पुनर्योगज डीएनए विधि के द्वारा होती है जिसमें संवाहक की आवश्यकता होती है। संवाहक से प्रतिकृति की शुरुआत होती है। मूल की प्रकृति और इस जगह पर होने वाले प्रक्रमों के बारे में आप विस्तृत रूप से उच्च कक्षाओं में पढ़ेंगे।
प्रतिकृति के बारे में अभी विस्तृत रूप से पूर्ण जानकारी नहीं है। ससीमकेंद्रकी सुकेंद्रकी में डीएनए की प्रतिकृति कोशिका चक्र के एस-प्रावस्था में होती है। डीएनए की प्रतिकृति व कोशिका विभाजन चक्र काफी संभावित ढंग से होती है। डीएनए प्रतिकृति के बाद कोशिका विभाजन न होने के कारण बहुगुणिता (पॉलीप्लॉयडी) की स्थिति (गुणसूत्री समानता) उत्पन्न होती है। इनमें से कुछ प्रक्रमों के बारे में विस्तृत रूप से आप उच्च कक्षाओं में पढ़ंगे।
5.5 अनुलेखन ( ट्रांसक्रिप्शन )
डीएनए की एक रज्जुक से आनुवंशिक सूचनाओं का आरएनए में प्रतिलिपीकरण करने की प्रक्रिया को अनुलेखन कहते हैं। यहाँ भी पूरकता का सिद्धांत अनुलेखन प्रक्रम को नियंत्रित करता है जिसमें एडिनोसिन थाइमिन की जगह पर यूरेसिल के साथ क्षारयुग्म बनाता है। यद्यपि प्रतिकृति प्रक्रम के विपरीत किसी जीव के कुल डीएनए द्विगुणित होकर अनुलेखन के दौरान अपना एक रज्जुक आरएनए के साथ मिलाकर उसी का रूप ले लेता है। इससे डीएनए की लड़ी व जगहों का पता चलता है जो अनुलेखन में भाग लेते हैं।
अनुलेखन के दौरान दोनों रज्जुकों की प्रतिलिपीकरण क्यों नहीं होती है। इसका साधारण सा उत्तर है। प्रथम, दोनों रज्जुक टेम्प्लेट के रूप में कार्य करते हैं तब उनसे विभिन्न अनुक्रमों वाले आरएनए अणुओं का अनुलेखन होता है (याद रखो पूरकता का मतलब समानता नहीं है), यदि प्रोटीन का कूटलेखन करते हैं तब प्रोटीन में मिलने वाले एमीनो अम्लों का अनुक्रम भिन्न होगा। यदि इसी डीएनए का एक भाग दो भिन्न प्रोटीनों का कूटलेखन करता है तब आनुवंशिक सूचना स्थानांतरण तंत्र द्वारा जटिलता उत्पन्न करती है। दूसरा साथ-साथ दो आरएनए अणुओं जो एक दूसरे के पूरक है। इनके निर्माण से द्विरज्जुक आरएनए का निर्माण होगा। इससे आरएनए के प्रोटीन में अनुलेखन नहीं हो पाता है और अनुलेखन का प्रयास व्यर्थ जाता है।
5.5.1 अनुलेखन इकाई
डीएनए में अनुलेखन इकाई के मुख्यतया तीन भाग होते हैं-
(क) उन्नायक (प्रमोटर)
(ख) संरचनात्मक जीन (स्ट्रक्चरल जीन)
(ग) समापक (टर्मीनेटर)
अनुलेखन इकाई के संरचनात्मक जीन डीएनए के द्विरज्जुक का ही भाग है। चूँकि रज्जुक विपरीत ध्रुवत्व की ओर होते हैं इसलिए डीएनए - निर्भर आरएनए पॉलीमरेज बहुलकन केवल एकदिशा $5^{\natural}$ से $3^{4}\left(5^{4} \rightarrow 3^{t}\right)$ की ओर उत्प्रेरित होते हैं। रज्जुक जिसमें ध्रुवत्व $3^{t}$ से $5^{t}\left(3^{t} \rightarrow 5^{t}\right)$ की ओर है। वह टेम्पलेट के रूप में कार्य करते हैं इसलिए यह टेम्पलेट रज्जुक कहलाता है। दूसरी लड़ी जिसमें ध्रुवत्व $\left(5^{4} \rightarrow 3^{t}\right)$ व अनुक्रम आरएनए जैसा होता है (थाइमीन के अलावा इस जगह पर यूरेसिल होता है)। अनुलेखन के दौरान स्थानांतरित हो जाता है। यह रज्जुक (जो किसी भी चीज़ के लिए कूटलेखन नहीं करता है) कूटलेखन रज्जुक कहलाता है। सभी उपर्युक्त बिंदु जो अनुलेखन इकाई के भाग है कूटलेखन रज्जुक से बने होते हैं। उन बिंदुओं की व्याख्या के लिए अनुलेखन ईकाई के परिकल्पित अनुक्रमों को नीचे दिखाया गया है।
$3^{\prime}$-ए टी जी सी ए टी जी सी ए टी जी सी ए टी जी सी ए टी जी सी ए टी जी सी ए टी जी सी $5^{\prime}$ टेम्प्लेट रज्जुक
$5^{\prime}$-टी ए सी जी टी ए सी जी टी ए सी जी टी ए सी जी टी ए सी जी टी ए सी जी $-3^{\prime}$ कूटलेखन रज्जुक
उपरोक्त डीएनए से अनुलेखित आरएनए के अनुक्रमों को क्या आप लिख सकते हो?
चित्र 5.9 अनुलेखन एकल की आरेखिय संरचना
उन्नायक व समापक तथा किनारे पर स्थित संरचनात्मक जीन अनुलेखन ईकाई बनाते हैं। संरचनात्मक जीन के $5^{4}$ - किनारे पर (इसका संदर्भ कूटलेखन रज्जुक के ध्रुवत्व के संबंध में है) उन्नायक स्थित होता है। यह डीएनए अनुक्रम है जिससे आरएनए पॉलीमरेज जुड़ता है और अनुलेखन ईकाई में स्थित उन्नायक टेम्प्लेट व कूटलेखन रज्जुक का निर्धारण करता है। समापक कूटलेखन रज्जुक के $3^{t}$ किनारे (अनुप्रवाह) पर स्थित होता है और इससे अनुलेखन प्रक्रम की समाप्ति का निर्धारण होता है (चित्र 5.9)। इसके अतिरिक्त उन्नायक के प्रतिप्रवाह व अनुप्रवाह की तरफ नियामक अनुक्रम होते हैं। इन अनुक्रमों की कुछ विशेषताओं के बारे में जब जीन अभिव्यक्ति नियमन के बारे में वर्णन होगा, तब जानकारी दी जाएगी।
5.5.2 अनुलेखन इकाई व जीन
जीन वंशागति की क्रियात्मक इकाई है। इसमें कोई संदेह नहीं है कि जीन डीएनए पर स्थित होते हैं। जीन को डीएनए अनुक्रम के शब्दों में साहित्यिक रूप से परिभाषित करना कठिन है। टीआरएनए अथवा आरआरएनए अणु डीएनए अनुक्रम अंतरण के लिए कार्य करते हैं उनसे भी जीन परिभाषित होता है। परिभाषा के अनुसार समपार (सीस्ट्रान) डीएनए का वह खंड है जो पॉलीपेप्टाइड का कूटलेखन करता है, अनुलेखन ईकाई में संरचनात्मक जीन मोनोसीस्ट्रानीक (अधिकतर सुकेंद्री में) या पॉलीसीस्ट्रानिक (अधिकतर जीवाणु में या असीमकेंद्री में) हो सकता हैं। सुकेंद्रकी में मोनोसिस्ट्रानिक संरचनात्मक जीन मिलती है जिसमें अंतरापित कूटलेखन अनुक्रम पाए जाते है - सुकेंद्री में जीन विखंडित होते हैं। कूटलेखन अनुक्रम या अभिव्यक्त अनुक्रमों को व्यक्तेक (एक्जान) कहते हैं। व्यक्तेक वे अनुक्रम हैं जो परिपक्व या संसाधित आरएनए में मिलते हैं। व्यक्तेक, अव्यक्तेक (इंट्रान) द्वारा अंतरापित होते हैं। अव्यक्तेक या मध्यवर्ती अनुक्रम परिपक्व या संसाधित आरएनए में नहीं मिलते हैं। डीएनए खंड के अर्थ में अंतरापित जीन व्यवस्था जीन की परिभाषा को जटिल बना देती है।
लक्षण की वंशागति संरचनात्मक जीन के उन्नायक व नियामक अनुक्रमों द्वारा प्रभावित होते हैं। चूँकि कभी-कभी नियामक अनुक्रम अस्पष्ट रूप से नियामक जीन कहलाते हैं, इसके बावजूद ये अनुक्रम किसी आरएनए या प्रोटीन का कूटलेखन नहीं करते हैं।
5.5.3 आरएनए के प्रकार व अनुलेखन का प्रक्रम
जीवाणु में मुख्यतया तीन प्रकार के आरएनए होते हैं - दूत आरएनए (आरआरएनए; मेसेंजर आरएनए) अंतरण आरएनए (टीआरएनए; ट्रांसफर आरएनए), व राइबोसोमल आरएनए (आरआरएनए) ए सभी तीन आरएनए कोशिका में प्रोटीन संश्लेषण के लिए आवश्यक है। एमआरएनए टेम्पलेट प्रदान करता है, टी आरएनए एमीनो अम्लों के लाने व आनुवंशिक कूट को पढ़ने का काम व आरआरएनए स्थानांतरण के दौरान संरचनात्मक व उत्प्रेरक की भूमिका निभाता है। जीवाणु में डीएनए पर निर्भर केवल एक आरएनए पॉलीमरेज होता है जो सभी प्रकार के आरएनए के अनुलेखन को उत्प्रेरित करता है। आरएनए पॉलीमरेज उन्नायक से जुड़कर अनुलेखन की शुरुआत (प्रारंभन) करते हैं। यह ट्राइफॉस्फेट को क्रियाधार के रूप में प्रयोगकर पूरकता के नियम का अनुपालन करते हुए टेम्प्लेट में बहुलकित हो जाता है। यह कुंडली को आगे खुलने व उसकी दीर्घीकरण में सहायता करता है। केवल छोटी लंबाई वाला आरएनए एंजाइम से जुड़ता है। जब आरएनए पॉलीमरेज समापक किनारे पर पहुँच जाता है तब नवनिर्मित आरएनए व आरएनए पॉलीमरेज अलग हो जाते हैं। इसके परिणामस्वरूप अनुलेखन का समापन हो जाता है।
यह एक जिज्ञासापूर्ण प्रश्न है कि आरएनए पॉलीमरेज किस तरह से उन तीनो चरणों प्रारंभन, दीर्घीकरण व समापन को उत्प्रेरित करता है। केवल आरएनए पॉलीमरेज ही दीर्घीकरण प्रक्रिया को उत्प्रेरित करने में सक्षम है। यह अस्थायी रूप से प्रारंभन कारक व समापन कारक से जुड़ जाता है। अनुलेखन की शुरुआत पॉलीमरेज के साथ जुड़ने से उसकी विशिष्टता में परिवर्तन के साथ होती है जिससे या तो प्रारंभन या समापन होता है (चित्र 5.10)।
चित्र 5.10 बैक्टीरिया में अनुलेखन प्रक्रिया
जीवाणु में सक्रिय दूत आरएनए के निर्माण में संसाधन की आवश्यकता नहीं होती है व अनुलेखन तथा स्थानांतरण एक कक्ष (जीवाणु में कोशिका विलेय व केंद्रक में कोई अलगाव नहीं होता है) में होता है, इसलिए कई बार स्थानांतरण दूत आरएनए के पूर्ण रूप से अनुलेखित होने के पहले ही प्रारंभ हो जाता है। फलस्वरूप अनुलेखन व स्थानांतरण जीवाणु में साथ-साथ संपन्न हो सकता है।
सुकेंद्रकी में दो अतिरिक्त जटिलताएँ हैं -
(क) केंद्रक (अंगकों में मिलने वाले पॉलीमरेज के अतिरिक्त) में कम-से-कम तीन प्रकार के आरएनए पॉलीमरेज मिलते हैं। इनमें कार्यों का स्पष्ट विभाजन है। आरएनए पॉलीमरेज I राइबोसोमल आर आरएनए (rRNA) (28s, 18s, व $5.8 \mathrm{~s}$ ) को अनुलेखित करता है, जबकि आरएनए पॉलीमरेज III अंतरण आरएनए (tRNA), 5 एस आर आरएनए (5srRNA) व एस एन आरएनए ( snRNAs ) (छोटा केंद्रकी आरएनए) के अनुलेखन के लिए जिम्मेदार है। आरएनए पॉलीमरेज II दूत आरएनए (mRNA) के पूर्ववर्ती रूप विषमांगी केंद्रकीय आरएनए (hnRNA) का अनुलेखन करते है।
चित्र 5.11 सुकेंद्रकियों में अनुलेखन प्रक्रिया
(ख) दूसरी जटिलता यह है कि प्रारंभिक अनुलेखन में व्यक्तेक व अव्यक्तेक दोनों मिलते हैं और वह असक्रिय होते हैं। चूँकि यह एक प्रक्रम से गुजरता है जिसे समबंधन (स्पलाइसिंग) कहते हैं जिसमें अव्यक्तेक अलग हो जाता है व व्यक्तेक एक निश्चित क्रम में आपस में जुड़ जाते हैं। $\mathrm{hn}$ आरएनए दो अतिरिक्त प्रक्रियाओं आच्छादन व पुच्छन से होकर गुजरता है। आच्छादन में एक असाधारण न्यूक्लियोराइड ( मेथिल ग्वानोसीन ट्राइफास्फेट) एचएनआरएनए के $5^{4}$ किनारे पर जुड़ता है। पुच्छन में एडेनीन समूह (200-300) स्वतंत्र रूप में टेम्पलेट के $3^{t}$ किनारे पर जुड़ जाता है। पूर्ण संसाधित एचएनआरएनए को अब दूत आरएनए ( $\mathrm{m}$ आरएनए) कहते हैं जो स्थानांतरण हेतु केंद्रक में स्थानांतरित हो जाता है (चित्र 5.11)।
उपरोक्त जटिलताओं के महत्त्व को अब समझने की आवश्यकता है। अंतरापित जीन व्यवस्था संभवतः जीनोम के पूर्व रूप को व्यक्त करता है। अव्येक्तेक की उपस्थिति पुराने समय की याद दिलाता है और संबंधन प्रक्रिया में आरएनए संसार की प्रभुता को व्यक्त करता है। वर्तमान समय में सजीव तंत्र में आरएनए निर्भर प्रक्रमों के बारे में समझने की अधिक आवश्यकता है।
5.6 आनुवंशिक कूट
प्रतिकृति व अनुलेखन के दौरान न्युक्लिक अम्ल से दूसरे न्युक्लिक अम्ल का प्रतिलिपिकरण होता है। इन प्रक्रमों को पूरकता के आधार पर समझना आसान है। स्थानांतरण की प्रक्रिया में आनुवंशिक सूचनाएँ न्यूक्लियोटाइड के बहुलक से एमीनों अम्लों के बहुलक की ओर स्थानांतरित होती है एमीनो अम्लों के न्यूक्लियोटाइड में न तो कोई पूरकता मिलती है न ही सैद्धांतिक रूप से इसके बारे में सोच सकते हैं। न्यूक्लिक अम्ल (आनुवंशिक पदार्थ) में परिवर्तन से प्रोटीन के एमीनो अम्ल में भी परिवर्तन हो जाता है। इस विचार के समर्थन हेतु पर्याप्त प्रमाण है। इससे आनुवंशिक कूट (जेनेटिक कोड) की परिकल्पना का प्रतिवादन हुआ जो प्रोटीन संश्लेषण के दौरान एमीनो अम्लों के अनुक्रम को निर्धारित करते हैं।
डीएनए की संरचना व आनुवंशिक पदार्थ के जैव रासायनिक प्रकृति का निर्धरण जितना उत्तेजना पूर्ण था, उससे ज्यादा आनुवंशिक कूट का अर्थ निकालना व प्रस्ताव करना चुनौतिपूर्ण था। सही अर्थों में इसके लिए विभिन्न क्षेत्रों के वैज्ञानिकों भौतिकविद्, कार्बनिक रसायनविद्य, जैव रासायनज्ञ व आनुवंशिकविद् के सहयोग की आवश्यकता थी। जार्ज गेमो एक भौतिकविद् थे जिनका विचार था कि यदि क्षार केवल चार हैं तो इन बीस अमीनो अम्ल का कूटलेखन किस रूप से होता है; अतः कूट के निर्माण में क्षारों का समूह बनता है। इनका विचार था कि सभी बीस अमीनो अम्लों के कूट हेतु, कोड तीन न्यूक्लियोराइडों के बने होते हैं। यह एक बहुत ठोस विचार था, जिससे $4^{3}(4 \times 4 \times 4)$ के प्रति उत्परिवर्तन समुच्चय से 64 कोड का निर्माण हुआ इनसे बनने वाले कोड आवश्यकता से अधिक थे। प्रकूट (कोडान) त्रिक होते हैं इसका प्रमाण देना अत्यधिक कठिन कार्य था। हर गोविंद खुराना ने निश्चित क्षारों (समबहुलक या सहबहुलक) के समुच्चय युक्त आरएनए अणुओं के संश्लेषण की रासायनिक विधि का विकास किया था। प्रोटीन संश्लेषण हेतु मार्शल नीटेनबर्ग की कोशिश स्वतंत्र तंत्र कूट का अर्थ निकालने में काफी सहयोगी रही। सेबवेटो ओकोआ एंजाइम (पॉलीन्यूक्लियोराइड फास्फोरीलेज) आरएनए को स्वतंत्र रूप (आरएनए का एंजाइम संश्लेषण) से टेम्प्लेट के निश्चित अनुक्रमों के साथ बहुलकित होने में सहायता प्रदान करता है। अंत में आनुवंशिक कूट का चेकर बोर्ड (पैनेट आरेख) नीचे तालिका 5.1 में दिया गया है -
तालिका 5.1 विभिन्न अमीनो अम्ल के लिए प्रकूट
आनुवंशिक कूट की प्रमुख विशेषताएँ निम्न है -
(क) प्रकूट त्रिक होता है। 61 प्रकूट अमीनो अम्ल का कूट लेखन करते हैं व तीन प्रकूट का कूट लेखन नहीं करते हैं इस कारण से यह रोध प्रकूट के रूप में कार्य करता है।
(ख) एक प्रकूट केवल एक अमीनो अम्ल का कूट लेखन करता है इस कारण से यह असंदिगध व विशिष्टि होता है।
(ग) कुछ अमीनो अम्ल का कूट लेखन एक से अधिक प्रकूटों द्वारा होता है, इस कारण से इन्हें अपह्रासित कूट कहते हैं।
(घ) प्रकूट दूत आरएनए में लगातार पढ़े जाते हैं। ये बीच में रुके हुए नहीं होते हैं।
(ङ) कूट लगभग सार्वभौमिक होते हैं, उदाहरणार्थ — जीवाणु से मनुष्य में यू यू यू (UUU) फेनिलएलेनीन (पीएचइ) का कूटलेखन करता है। इस नियम के कुछ अपवाद सूचकणिका प्रकूट व कुछ आदि जंतुओं (प्रोटोजोआ) में मिलता है।
(च) AUG दोहरा कार्य करते हैं। यह मीथियोनीन का कूट लेखन करता है। यह एक प्रारंभक प्रकूट के रूप में कार्य करता है।
यदि एक दूत आरएनए में निम्न न्युक्यिटाइड अनुक्रम है तो इनके द्वारा कूटलेखित अमीनो अम्ल के अनुक्रमों की कल्पना करो (चेकरबोर्ड की सहायता लीजिए)। -AUG UUU UUC UUC UUU UUU UUC-
अब इसके विपरीत के बारे में बताओ। नीचे दिए गए दूत आरएनए द्वारा कूटलेखित अमीनो अम्ल के अनुक्रम हैं। आरएनए में न्युकियोटाइड अनुक्रम का पता लगाओ
Met-Phe-Phe-Phe-Phe-Phe-Phe
क्या आप इसका विपरीत पता लगाने में परेशानी महसूस करते हैं? क्यों?
क्या आप अब आनुवंशिक कूट की दो विशेषताओं के बारे सामंजस्य बिठा सकते हैं, जिसके बारे में आप पढ़ चुके हैं?
5.6.1 उत्परिवर्तन व आनुवंशिक कूट
जीन व डीएनए के बीच आपसी संबंधों को उत्परिवर्तन द्वारा अच्छे ढंग से समझा जा सकता है। तुम उत्परिवर्तन और इसके प्रभाव के बारे में विस्तृत रूप से अध्याय 5 में पढ़ चुके हो। एक डीएनए के खंड में अधिक लोपन व पुनर्योजन के प्रभाव के बारे में आसानी से समझ सकते हो। इसके परिणाम स्वरूप जीन के कार्य की क्षति या वृद्धि होती है। बिंदु उत्परिवर्तन का एक प्रतिष्ठित उदाहरण बीटा ग्लोबिन शृंखला के जीन में एक क्षार युग्म में परिवर्तन के परिणामस्वरूप अमीनो अम्ल अवशिष्ट ग्लूटामेट से वैलीन में परिवर्तित होता है। इसके परिणाम स्वरूप होने वाले रोग को दात्र कोशिका सुरक्तता (सिकिल सेल एनीमिया) कहते हैं। बिंदु उत्परिवर्तन के कारण संरचनात्मक जीन में एक क्षार के प्रवेश या विलोपन के बारे में नीचे दिए गए साधारण उदाहरण के द्वारा अच्छी तरह से समझ सकते हैं।
इस कथन पर ध्यान दो जो निम्न शब्दों से बना है जिनमें तीन वर्ण (अक्षर) आनुवंशिक कूट की तरह मिलते हैं -
RAM HAS RED CAP
यदि HAS व RED बीच अक्षर $\mathrm{B}$ को डाला जाए और कथन को पुनर्योजित किया जाए तो इसे निम्नवत् पढ़ा जाएगा
RAM HAS BRE DCA P
ठीक इसी तरह से, उसी जगह पर हो अक्षर जो से $\mathrm{BI}$ अब इसे निम्नवत् पढ़ा जाएगा-
RAM HAS BIR EDC AP
अब हम एक साथ तीन अक्षरों जैसे $\mathrm{BIG}$ को डाले तो कथन को निम्नवत् पढ़ा जाएगा
RAM HAS BIG RED CAP
उपर्युक्त अभ्यास को RED अक्षरों को एक के बाद एक विलोपित कर दोहरा सकते हैं और यह त्रिक अक्षरों का वाक्य निम्नवत् बनेगा -
RAM HAS EDC AP
RAM HAS DGA P
RAM HAS CAP
उपर्युक्त अभ्यास से निष्कर्ष बहुत स्पष्ट है। एक या दो क्षारों के निवेशन या विलोपन से निवेशन या विलोपन बिंदु के पढ़ने के प्राधार (रीडिंग फ्रेम) में परिवर्तन होता है। यद्यपि ऐसे परिवर्तन का उल्लेख वाचन प्राधार निवेशन या विलोपन के रूप में किया जाता हैं। तीन या तीन क्षारों के गुणित निवेशन अथवा विलोपन से एक अथवा अनेक कोड तदनुसार एक अथवा अनेक एमीनो अम्ल के वाचन प्राधार इस बिंदु के आगे अपरिवर्तित रहते हैं।
5.6.2 अंतरण आरएनए अनुकूलक अणु
कूट परिकल्पना के बहुत समय पहले से फ्रेनसिस क्रिक के अनुसार कूट के पढ़ने व इसके अमीनो अम्ल से संबंध रखने वाली एक क्रियाविधि है, अणु क्योंकि अमीनो अम्ल में कोई संरचनात्मक विशिष्ता नहीं होती जिससे कि यह कूट को विशेष ढंग से पढ़ सके। इसके अनुसार एक अनुकूलतम अणु जो एक तरफ से कूट को पढ़ता है व दूसरे तरफ इससे विशिष्ट अमीनो अम्ल जुड़ जाते हैं। अंतरण आरएनए जिसे विलेय आरएनए (एसआरएनए) कहते हैं, के बारे में जानकारी आनुवंशिक कूट से पहले थी। फिर भी अनुकूलक अणु के रूप में इसकी भूमिका के बारे में बाद में जानकारी मिल पायी।
चित्र 5.12 tआरएनए-अनुकूलक
चित्र 5.13 स्थानांतरण (एंटीकोडान) फंदा होता है जिसमें कूट के पूरक क्षार मिलते हैं व इसमें एक अमीनो अम्ल स्वीकार्य छोर होता है जिससे यह अमीनो अम्ल से जुड़ जाता है। प्रत्येक अमीनो अम्ल के लिए विशिष्ट अंतरण आरएनए (tRNA) होते हैं (चित्र 5.12)। प्रारंभन हेतु दूसरा विशिष्ट अंतरण आरएनए होता है जिसे प्रारंभक अंतरण आरएनए कहते हैं। रोध प्रकूट के लिए कोई अंतरण आरएनए नहीं होता है। उपरोक्त चित्र में अंतरण आरएनए की द्वितीयक संरचना दर्शायी गयी है जो तिपतिया (क्लोवर) की पत्ती जैसी दिखायी देती है। वास्तविक संरचना के अनुसार अंतरण आरएनए सघन अणु है जो उल्टे एल (L) की तरह दिखाई देता है।
5.7 स्थानांतरण ( रूपांतरण )
स्थानांतरण या रूपांतरण वह प्रक्रिया है जिसमें अमीनो अम्लों के बहुलकन से पॉलीपेप्टाइड का निर्माण होता है (चित्र 5.13)। अमीनो अम्लों के क्रम व अनुक्रम दूत आरएनए में पाए जाने वाले क्षारो के अनुक्रम पर निर्भर करता है। अमीनो अम्ल पेप्टाइड बंध द्वारा जुड़े रहते हैं। पेप्टाइड बंध के निर्माण में ऊर्जा की आवश्यकता होती है। इस कारण से प्रथम प्रावस्था में अमीनो अम्ल स्वयं एटीपी के उपस्थिति में सक्रिय हो जाते है व सजातीय अंतरण आरएनए से जुड़ जाते हैं — इस प्रक्रिया को अधिक स्पष्ट रूप से अंतरण आरएनए का आवेशीकरण या अंतरण आरएनए एमीनोएसिलेशन कहते हैं। इस तरह से आवेशित दो अंतरण आरएनए का एक दूसरे से काफी पास में आने से उनमें पेप्टाइड बंध का निर्माण होता है। उत्प्रेरक की उपस्थिति में पेप्टाइड बंध बनने की दर बढ़ जाती है।
चित्र 5.13 स्थानांतरण
कोशकीय कारखाना जो प्रोटीन संश्लेषण के लिए आवश्यक है वह राइबोसोम है। राइबोसोम संरचनात्मक आरएनए व लगभग 80 विभिन्न प्रोटीनों से मिलकर बना होता है। यह अपनी निष्क्रिय अवस्था में दो उप एकको-एक बड़ी उप एकक व एक छोटी उपएकक से मिलकर बना होता है। जब छोटा उपएकक दूत आरएनए में मिलता है तब दूत आरएनए का प्रोटीन में स्थानांतरण की प्रक्रिया शुरू हो जाती है। बड़े उपएकक में दो स्थल होते हैं जिससे बाद में अमीनो अम्ल जुड़कर एक दूसरे के काफी पास में आ जाते हैं जिससे पॉली पेप्टाइड बंध बन जाता है। राइबोसोम पेप्टाइड बंध के निर्माण में उत्प्रेरक ( 23 राइबोसोमल आरएनए जीवाणु में एंजाइम - राइबोजाइम) का काम करता है।
दूत आरएनए में स्थानांतरण इकाई आरएनए का अनुक्रम है जिसके किनारो पर प्रारंभक प्रकूट (AUG स्टार्ट कोडान) व रोध प्रकूट (स्टाप कोडान) मिलते है जो पॉलीपेप्टाइड का कूटलेखन करते हैं। दूत आर एन में कुछ अतिरिक्त अनुक्रम होते हैं जो स्थानांतरित नहीं होते हैं उन्हें अस्थानातंरित स्थल (अनट्रांसलेटेड रीजन्स, यूटीआर) कहते हैं। यूटी आर दोनों $5^{4}$ - किनारा (प्रारंभक प्रकूट के पहले) व $3^{4}$ - किनारा (रोध प्रकूट के बाद) पर स्थित होता है। ये प्रभावी स्थानांतरण प्रक्रिया के लिए आवश्यक है।
प्रारंभन हेतु राइबोसोम दूत आरएनए के प्रारंभक प्रकूट (AUG) से बंधता है जिसकी पहचान प्रारंभक अंतरण आरएनए द्वारा की जाती है। राइबोसोम इसके बाद प्रोटीन संश्लेषण की दीर्घीकरण प्रावस्था की ओर बढ़ता है। इस अवस्था में एमीनो अम्ल अंतरण आरएनए से जुड़कर एक जटिल रचना का निर्माण करते हैं जो आगे चलकर अंतरण आरएनए के प्रति प्रकूट (एंटीकोडान) से पूरक क्षार युग्म बना कर दूत आरएनए के उचित प्रकूट से जुड़ जाते हैं। राइबोसोम दूत आरएनए के साथ एक प्रकूट से दूसरे प्रकूट की ओर जाता है। एक के बाद एक अमीनो अम्लों के जुड़ने से पॉली पेप्टाइड अनुक्रमों का स्थानांतरण होता है जो डीएनए द्वारा निर्देशित व दूत आरएनए द्वारा निरूपित होते हैं। अंत में विमोचक कारक का रोध प्रकूट से जुड़ने से स्थानांतरण प्रक्रिया का समापन हो जाता है व राइबोसोम से पूर्ण पॉलीपेप्टाइड अलग हो जाते हैं।
5.8 जीन अभिव्यक्ति का नियमन
जीन अभिव्यक्ति के नियमन का बहुत व्यापक अर्थ है जो विभिन्न स्तरों पर होती है। जीन अभिव्यक्ति के परिणामस्वरूप पॉलीपेप्टाइड का निर्माण होता है जिसे कई स्तरों पर नियमित कर सकते हैं। सुकेंद्रकी में नियमन कई स्तर पर हो सकता है-
(क) अनुलेखन स्तर (प्रारंभिक अनुलेख का निर्माण)
(ख) संसाधन स्तर (संबंधन का नियमन)
(ग) दूत आरएनए का केंद्रक से कोशिकाप्रवण में अभिगमन
(घ) स्थानांतरीय स्तर।
जीन कोशिका में अभिव्यक्त होकर एक विशेष कार्य या एक निश्चित कार्य को संपन्न करते हैं। उदाहरणार्थ-ई. कोलाई में स्थित एंजाइम बीटा-गैलेक्टोसाइडेज डाइसैकेटाइड-लैक्टोज का जल अपघटन कर गैलेक्टोज व ग्लूकोज का निर्माण करते हैं जिसे जीवाणु ऊर्जा के स्रोत के रूप में प्रयोग करते हैं। लैक्टोज जो जीवाणु के ऊर्जा स्रोत हैं कि अनुपस्थिति में बीटा गैलेक्टोसाइडेज एंजाइम का संश्लेषण नहीं होता है। इस कारण से साधारण शब्दों में कहा जाए तो यह एक उपापचयी, शरीर क्रियात्मक या वातावरण स्थिति है जो जीन की अभिव्यक्ति को नियमित करती है। एक भ्रूण का व्यस्क जीव में विकास व विभेदन जीन के विभिन्न समूहों की अभिव्यक्ति समंवित नियमन का परिणाम है।
असीमकेंद्रकी में जीन अभिव्यक्ति के नियंत्रक के लिए कुछ ऐसे प्रभावी स्थल होते हैं जो अनुलेखन प्रारंभन की दर को नियमित करते हैं। अनुलेखन ईकाई में एक निश्चित उन्नायक के साथ आरएनए पॉलीमरेज की क्रियाशीलता अतिरिक्त प्रोटीन से पारस्परिक क्रिया द्वारा उसे नियमित होती है जो प्रारंभक स्थल के पहचान में इसे सहयोग देते हैं। ये नियामक प्रोटीन सहयोगात्मक (सक्रिया, एक्टिवेटर) या असहयोगात्मक (दमनकारी, रिप्रेसर) दोनों रूप में कार्य कर सकते हैं। असीमकेंद्रकी डीएनए में उन्नायक स्थल की उपलब्धता प्रोटीन की विशेष अनुक्रमों जिसे प्रचालक (आपरेटर) कहते हैं से अन्योय क्रिया द्वारा नियमित होती रहती है। अधिकतर प्रचालेक (औपरॉन) में प्रचालक स्थल, उन्नायक भाग के पास में ही स्थित होता है और अधिकतर स्थिति में प्रचालक के अनुक्रम दमनकारी प्रोटीन से बँध जाते हैं। प्रत्येक औपरॉन का अपना विशिष्ट प्रचालेक व दमनकारी (रिप्रेशर) होता है। उदाहरण-लैक प्रचालेक केवल लैक-प्रचालेक (एलएसी-आपरेटर) में मिलता है यह विशेषरूप से लैक-दमनकारी (एलएसी-रिप्रेसर) से आपसी क्रिया करता है।
5.8.1 लैक प्रचालेक ( लैक-ओपेरान )
लैक ओपेरान के बारे स्पष्ट जानकारी आनुवंशिकीविज्ञ फ्रेंक्वास जैकब व जैव रसायनविज्ञ जैक्वे मोनाड के आपसी प्रयास से हो पायी है। उन्होंने पहली बार अनुलेखनीय नियमित तंत्र के बारे में बताया। लैक-प्रचालेक (यहाँ लैक का मतलब लैक्टोज है) में पॉलीसीसट्रानिक संरचनात्मक जीन का नियमन एक सामान्य उन्नायक व नियामक जीन द्वारा होता है। इस तरह की व्यवस्था जीवाणु में बहुत सामान्य है इसे प्रचालेक (ओपेरान) कहते हैं। ऐसे कुछ उदाहरण है - लैक प्रचालेक (एलएसी ओपेटान), ट्रिप प्रचालेक (टीआरपी - ओपेरान), एटा-प्रचालेक (एआरए-ओपेरान), हिस प्रचालेक (एचआईएस ओपेरान), व वैल-प्रचालेक (बीएएल-ओपेरान) आदि।
लैक प्रचालेक एक नियामक जीन (आई (i) जीन - यहाँ आई का मतलब प्रेरक (इनडयूसर) नहीं, बल्कि यह शब्द मंदक (इनहिबीटर) से किया गया है और तीन संरचनात्मक जीन (जेड, वाई व ए) से मिलकर बना होता है। आई (i) जीन लैक प्रचालेक के दमनकारी का कूटलेखन करता है। जेड जीन बीटा-गैलेक्टोसाइडेज (बीटा-गाल; $\beta$-gal) का कूट लेखन करता है जो डाइसैकेटाइड लैक्टोज के जल विघटन से एकलक ईकाई गैलेक्टोज व ग्लूकोज का निर्माण करता है। वाई $(y)$ जीन परमीएज का कूटलेखन करता है जो कोशिका के लिए बीटा-गैलेक्टोसाइडेज की पारगम्यता को बढ़ता है। जीन ए (a) द्वारा ट्रांसएसिटीलेज का कूटलेखन होता है। इस तरह से लैक-प्रचालेक के सभी तीनों जीन के उत्पाद लैक्टोज उपापचय के लिए आवश्यक है। दूसरे अन्य प्रचालेकों के प्रचालेक में उपस्थित जीन समान संबंधित उपापचयी पथ में एक साथ कार्य करते हैं (चित्र 5.14)।
चित्र 5.14 लैक ओपेरान
लैक्टोज एंजाइम बीटा-गैलेक्टोसाइडेज के लिए क्रियाधार का काम करता है जो प्रचालेक की सक्रियता के आरंभ (आन) या निष्क्रियता समाप्ति (आफ) को नियमित करता है। इसे प्रेरक कहते हैं। सबसे उपयुक्त कार्बन स्रोत-ग्लूकोज की अनुपस्थिति में यदि जीवाणु के संवर्धन माध्यम में लैक्टोज डाल दिया जाता है तब परमिएड की क्रिया द्वारा लैक्टोज कोशिका के अंदर अभिगमन करता है। (याद करो कोशिका में लैक-प्रचालेक की अभिव्यक्ति निम्न स्तर पर हमेशा बनी रहती है अन्यथा लैक्टोज कोशिकाओं के भीतर प्रवेश नहीं कर सकता है)। इसके बाद लैक्टोज प्रचालेक को निम्न ढंग से प्रेरित करता है।
प्रचालेक का दमनकारी आई (i) जीन द्वारा संश्लेषित (हमेशा उपस्थित रहता है) होता है। दमनकारी प्रोटीन प्रचालेक के प्रचालक स्थल से बंधकर आरएनए पॉलीमरेज को निष्क्रिय कर देता है जिससे प्रचालेक अनुलेखित नहीं हो पाता है। प्रेरक जैसे लैक्टोज (या एलोलैक्टोज) की उपस्थिति में दमनकारी प्रेरक से क्रियाकर निष्क्रियित हो जाता है। इसके फलस्वरूप आरएनए पॉलीमरेज उन्नायक से बँध कर अनुलेखन की शुरुआत करता है (चित्र 5.14)। लैक प्रचालेक के नियमन को इसके क्रियाधार द्वारा एंजाइम के संश्लेषण के रूप में निरुपित किया जा सकता है।
याद रखो लैक-प्रचालेक किए ग्लूकोज या गैलेक्टोज प्रेरक के रूप में कार्य नहीं कर सकता है। क्या तुम बता सकते हो लैक्टोज की उपस्थिति में कब तक लैक-प्रचालेक अभिव्यक्त हो सकता है?
दमनकारी द्वारा लैक-प्रचालेक के नियमन को ऋणात्मक नियमन (निगेटीव रेग्यूलेशन) कहते है। लैक प्रचालेक धनात्मक नियमन (पाजीटीव रेग्यूलेशन) के नियंत्रण में भी होता है, लेकिन इस स्तर पर इसके बारे में चर्चा नहीं कि जाएगी।
5.9 मानव जीनोम परियोजना ( ह्यूमन जीनोम प्रोजेक्ट )
पिछले खंडों में तुम पढ़ चुके हो कि डीएनए में मिलने वाले क्षारों का अनुक्रम किसी भी जीव का आनुवंशिक सूचना का निर्धारण करता है। दूसरे शब्दों में किसी भी जीव की आनुवंशिक व्यवस्था उसके डीएनए में मिलने वाले अनुक्रम से निर्धारित होती है। दो विभिन्न व्यक्तियों में मिलने वाला डीएनए अनुक्रम कुछ जगहों पर भिन्न-भिन्न होता है। ये कल्पनाएँ मानव जीनोम में मिलने वाले पूर्ण डीएनए अनुक्रम के बारे में पता लगाने के लिए विवश करती हैं। आनुवंशिक अभियांत्रिक तकनीकों के विकास से किसी भी, डीएनए खंड को विलगित व क्लोन किया जा सकता है व डीएनए अनुक्रमों को शीघ्र जानने के लिए साधारण तकनीक के विकास से 1990 में मानव जीनोम के अनुक्रमों को पता लगाने के लिए एक महत्त्वाकांक्षी योजना की शुरुआत हुई।
मानव जीनोम योजना (एचजीपी) महायोजना (मेगा प्रोजेक्ट) कहलाती है। यदि इस योजना के उद्देश्यों को ध्यान दें तो इसके विस्तार व आवश्यकता के बारे में कल्पना कर सकते हैं -
मानव जीनोम में लगभग $3 \times 10^{9}$ क्षार युग्म मिलते हैं; यदि अनुक्रम जानने के लिए प्रति क्षार तीन अमेरिकन डॉलर (US $ 3) खर्च होते हैं तो पूरी योजना पर खर्च होने वाली लागत लगभग 9 बिलियन अमेरिकी डॉलर होगा। प्राप्त अनुक्रमों को टंकणित रूप में किताब में संग्रहित किया जाए तो जिसके प्रत्येक पृष्ठ में 1000 अक्षर हो तो इस प्रकार इस किताब में 1000 पृष्ठ होंगे तब इस तरह से एक मानव कोशिका के डीएनए सूचनाओं को संकलित करने हेतु 3300 किताबों की आवश्यकता होगी। इस प्रकार बड़ी संख्या में आँकड़ों की प्राप्ति के लिए उच्च गतिकीय संगणक साधन की आवश्यकता होगी है जिससे आँकड़ों के संग्रह, विश्लेषण व पुनः उपयोग में सहायता मिलती है। एचजीपी के बारे में जानकारी जीव विज्ञान के इस नए क्षेत्र का तेजी से विस्तार से संभव हो पाया जिसे जैव सूचना विज्ञान (बायोइनफार्मेटिक्स) कहते हैं।
एच जी पी के लक्ष्य
(क) मानव डीएनए में मिलने वाले एचजीपी के कुछ महत्त्वपूर्ण लक्ष्य निम्नलिखित हैं लगभग - $20,000-25,000$ सभी जीनों के बारे में पता लगाना,
(ख) मानव डीएनए को बनाने वाले 3 बिलियन रासायनिक क्षार युग्मों के अनुक्रमों को निर्धारित करना,
(ग) उपरोक्त जानकारी को आँकड़ों के रूप में संग्रहित करना,
(घ) आँकड़ों के विश्लेषण हेतु नयी तकनीक का सुधार करना,
(ङ) संबंधित प्रौद्योगिकियों को उद्योगों जैसे अन्य क्षेत्रों में स्थानांतरित करना;
(च) योजना द्वारा उठने वाले नैतिक, कानूनी व सामाजिक मुद्दों (इ एल एस आई) के बारे में विचार करना।
मानव जीनोम परियोजना 13 वर्ष की योजना का जिसे अमेरिकी ऊर्जा विभाग (यू एस डिपार्टमेंट ऑफ इनर्जी) व राष्ट्रीय स्वास्थ्य संस्थान (नेशनल इंस्टीट्यूट ऑफ हेल्थ) द्वारा सहयोग प्राप्त था। प्रारंभिक वर्षों में वेलकम न्यास (यू.के.) की एचजीपी में भागीदारी थी और बाद में जापान, फ्रांस, जर्मनी, चीन व अन्य देशों द्वारा सहयोग प्रदान किया गया। यह योजना 2003 में पूर्ण हो गई। विभिन्न व्यक्तियों में मिलने वाले डीएनए की विभिन्नता के बारे में प्राप्त जानकारी से मानव में मिलने वाले हजारों अनियमितताओं के बारे में पहचानने, उपचार करने व कुछ हद तक उनके रोकने में सहायता मिली है। इसके अतिरिक्त मानव जीव विज्ञान के सुरागों को समझने, अमानवीय जीवों के डीएनए अनुक्रमों की प्राप्त जानकारी के आधार पर उनकी प्राकृतिक क्षमताओं का उपयोग कर स्वास्थ्य सुरक्षा, कृषि, ऊर्जा उत्पादन व पर्यावरण सुधार की दिशा में उठने वाली चुनौतियों को हल किया सकता है। कई अमानवीय प्रतिरूप-जीवों गैसे-जीवाणु, यीस्ट, केएनोरहेब्डीटीस इलीगेंस (स्वतंत्र अरोगजनक सूत्रकृमि), ड्रासोफिला (फलमक्खी), पौधा (धान व एरेबीडाप्सीस) आदि के अनुक्रमों के बारे में जानकारी प्राप्त हुई है।
कार्य-प्रणालियाँ- इन विधियों में दो महत्त्वपूर्ण तरीकों का उपयोग किया गया है। पहले प्रयास में उन सभी जीन जो आरएनए के रूप में व्यक्त होते हैं उनके बारे में ध्यान देना इसे व्यक्त अनुक्रम घुंडी (इक्सेप्रेस्ड सीक्वेंश टैग्स, ESTs)। दूसरा प्रयास यह है कि जीन में मिलने वाले सभी जीनोम के व्यक्तेक व अव्यक्तेक अनुक्रमों की जानकारी प्राप्त कर उनके कार्यों को निर्धारित करना (इसे अनुक्रम टिप्पण या सिक्वेंस एनोटेसन कहते हैं) हैं। कोशिका के पूर्ण डीएनए में स्थित अनुक्रमों की जानकारी के लिए पहले इसे विलगित कर छोटे-छोटे यादृच्छिक खंड (याद करो डीएनए एक बहुत लंबा बहुलक है इस कारण से डीएनए के लंबे टुकड़ों के अनुक्रमण में परेशानी होती है) बना कर संवाहकों का उपयोग उचित आतिथेय में भेज देते हैं। क्लोनिंग प्रत्येक डीएनए के प्रवर्धन में सहायता करता है जिससे इन अनुक्रमों के बारे में जानकारी मिलना आसान हो जाता है। सामान्यतया उपयोगी आतिथेय जीवाणु व यीस्ट है और संवाहकों को बी ए सी (जीवाणु कृत्रिम गुणसूत्र; बैक्टिरियल आर्टिफिशियल क्रोमोसोम) व वाइ ए सी (यीस्ट कृत्रिम गुणसूत्र; यीस्ट आर्टिफिशियल क्रोमोसोम) कहते हैं।
चित्र 5.15 मानव जीनोम परियोजना का निरूपक आरेख
खंडों को स्वचालित डीएनए अनुक्रमक (डीएनए सीक्वेंसर) जो फ्रेडरिक सेंगर द्वारा विकसित विधि के सिद्धांत पर कार्य करता है का उपयोग कर अनुक्रमण करते हैं। (याद करो, प्रोटीन में अमीनो अम्लों के अनुक्रमों को निर्धारित करने वाली विधि के विकास का श्रेय भी सेंगर को ही जाता है)। इन अनुक्रमों को एक दूसरे में स्थित अंशछादन (ओवर लैपिंग) के आधार पर व्यवस्थित करते हैं। अनुक्रमण हेतु अंशछादन खंडों का निर्माण होना आवश्यक है। इन अनुक्रमों को मनुष्य द्वारा पंक्तिबद्ध करना संभव नहीं है। इस कारण से कम्प्यूटर आधारित विशेष प्रक्रमन (प्रोग्राम) के विकास की आवश्यकता है (चित्र 5.15) बाद में इन अनुक्रमकों का टिप्पणी कर प्रत्येक गुणसूत्र के साथ निर्धारित किया गया। गुणसूत्र 1 का अनुक्रमण में मई 2006 (यह मानव के 24 गुणसूत्रों में अंतिम था $-22-3$ लिंग गुणसूत्र और $\mathrm{X}$ तथा $\mathrm{Y}$ की अनुक्रमण की आवश्यकता है)। दूसरा चुनौतीपूर्ण कार्य जीनोम का आनुवंशिक व भौतिक नक्शे तैयार करना था। बहुरूपीय प्रतिबंधन एंडोन्यूक्लीएज पहचान स्थल व दोहराए गए डीएनए के अनुक्रमों, जिसे सूक्ष्म अनसंगीय (माइक्रोसैटेलाईट) (दोहराए गए डीएनए अनुक्रमों में बहुरूपीय की उपयोगिता के बारे में अगले खंड डीएनए फिंगरप्रिंटिंग में पढ़ेंगें) कहते हैं।
5.9.1 मानव जीनोम की मुख्य विशेषताएँ
मानव जीनोम परियोजना से प्राप्त विशेष परिक्षण निम्नवत हैं -
(क) मानव जीनोम 3164.7 करोड़ क्षार युग्म मिलते हैं।
(ख) औसतन प्रत्येक जीन में 3000 क्षार स्थित हैं जिनके आकार में अधिक विभिन्नताएँ हैं। मनुष्य को ज्ञात सबसे बड़ी जीन डिसट्रॉफिन (Dystrophin) में 2.4 करोड़ क्षार मिले हैं।
(ग) जीन की संख्या 30,000 है जो पहले की अनुमानित संख्या 80,000 से 140,000 से काफी कम है। लगभग सभी ( 99.9 प्रतिशत) लोगों में मिलने न्यूक्लियो टाइड्स क्षार एक समान है।
(घ) खोजी गई 50 प्रतिशत से अधिक जीन के कार्य के बारे में जानकारी प्राप्त है।
(ङ) दो प्रतिशत से कम जीनोम प्रोटीन का कूटलेखन करते हैं।
(च) मानव जीनोम के बहुत बड़े भाग का निर्माण पुनरावृत्ति अनुक्रम द्वारा होता हैं।
(छ) पुनरावृत्ति अनुक्रम डीएनए के फैले हुए भाग हैं जिनकी कभी-कभी सौ से हजार बार पुनरावृत्ति होती है। जिनके बारे में यह विचार है कि इनका सीधा कूटलेखन में कोई कार्य नहीं है लेकिन इनसे गुणसूत्र की संरचना, गतिकीय व विकास के बारे में जानकारी प्राप्त होती है।
(ज) गुणसूत्र 1 में सर्वाधिक जीन (2968) व $\mathrm{Y}$ गुणसूत्र में सबसे कम जीन (231) मिलते हैं।
(झ) वैज्ञानिकों ने मानव में लगभग 1.4 करोड़ जगहों पर अलग इकहरा क्षार (SNPs - एकल न्यूक्लियोटाइड बहुरूपता; सिंगल न्यूक्लियोटाइड पॉलीमारफीज़्म; जिसे ‘स्निप्स’ कहा जाता है) का पता लगाया। उपरोक्त जानकारी से गुणसूत्रों में उन जगहों जो रोग आधारित अनुक्रम मानव इतिहास का पता लगाने में सहायक है के बारे में जानकारी एकत्र करने में काफी सहयोग प्रदान किया।
5.9.2 उपयोग व भविष्य की चुनौतियाँ
डीएनए अनुक्रमों से प्राप्त सार्थक जानकारियाँ व शोधों से आने वाले दशकों में जैविक तंत्र को समझने में काफी सहुलियत रही। इस वृहद् कार्य को पूर्ण करने में विश्व के सार्वजनिक व असावर्जनिक क्षेत्र के कई हजार विभिन्न क्षेत्रों के विशेषज्ञों व रचनाकारों का योगदान रहा। एच जी अनुक्रमों का सबसे महत्त्वपूर्ण प्रभाव यह रहा कि जैविक अनुसंधानों में मूलतः नए आयामों का समावेश हो सका। पहले शोधकर्त्ता एक समय पर एक या कुछ जीन के बारे में ही अध्ययन कर पाते थे। पूर्ण जीनोम अनुक्रमों व नयी तकनीकों के आधार पर अब काफी व्यापक स्तर व व्यवस्थित तरीके से उठने वाले प्रश्नों को हल करने में सहायता मिली है। इससे जीनोम में मिलने वाले सभी जीन के बारे में अध्ययन किया जा सका, उदाहरणार्थ — विशेष ऊतकों या अंग या अर्बुद में मिलने वाले सभी अनुलेखों व हजारों जीन व प्रोटीन आपस में जुड़े हुए तार की तरह कैसे कार्य करते है इनसे प्राप्त जानकारी से जीवन के रसायन को वांच्छनीय बनाने में उपयोगी रहा।
5.10 डीएनए अंगुलिछापी ( डीएनए फिंगर प्रिंटिंग )
पिछले खंड में यह बताया गया है कि मनुष्यों में मिलने वाले क्षार अनुक्रम लगभग 99.9 प्रतिशत समान होते हैं। यह मानते हुए कि मानव जीनोम में $3 \times 10^{9}$ क्षार युग्म है तो कितने क्षार अनुक्रमों में अंतर है? डीएनए के अनुक्रम में मिलने वाले अंतर व्यक्ति विशेष के समलक्षणीय रूप आकार को निर्धारित करते हैं। यदि किसी का उद्देश्य दो व्यक्तियों या किसी जनसंख्या के लोगों के बीच आनुवंशिक विभिन्नता का पता लगाना हो तो हमेशा डीएनए का अनुक्रम ज्ञात करना होगा जो एक कठिन व महँगा कार्य है। कल्पना करो कि दो $3 \times 10^{6}$ क्षार के बीच तुलना की है। दो व्यक्तियों के डीएनए अनुक्रमों के बीच तुलना करने हेतु डीएनए अंगुलिछापी एक त्वरित विधि है।
डीएनए अंगुलिछापी में डीएनए अनुक्रम में स्थित कुछ विशिष्ट जगहों के बीच विभिन्नता का पता लगाते हैं इसको पुनरावृत्ति डीएनए (रीपीटेटिव डीएनए) कहते हैं; अनुक्रमों में डीएनए का छोटा भाग कई बार पुनरावृत होता है। इस पुनरावृत्ति डीएनए को जीनोमिक डीएनए के ढेर से अलग करने के लिए जो विभिन्न शिखर बनाते है घनत्व प्रवणता अपकेंद्रीकरण द्वारा अलग करते हैं। डीएनए ढेर एक बहुत बड़ा शिखर बनाता है जबकि साथ में अन्य छोटे शिखर बनते है जिसे अनुषंगी डीएनए (सेटेलाइट डीएनए) कहते हैं। क्षार घटकों, खंडों की लंबाई, व पुनरावृत्ति ईकाईयों के आधार पर अनुषंगी, लघु-अनुषंगी आदि में वर्गीकृत किया गया है। अनुक्रम समान्यतया किसी भी प्रोटीन का कूटलेखन नहीं करते हैं, लेकिन ये मानव जीनोम के अधिकांश भाग में मिलते हैं। ये अनुक्रम उच्चश्रेणी बहुरूपता प्रदर्शित करते हैं जो डीएनए अंगुलिछापी का आधार है। किसी भी व्यक्ति के विभिन्न ऊतकों (जैसे-खून, बाल पुटक, त्वचा, हड्डी, लार, शुक्राणु आदि) से प्राप्त डीएनए में एक समान बहुरूपता मिलती है जो न्यायालयीन उपयोग में एक पहचान औजार के रूप में उपयोगी है। चूँकि बहुरूपता जनक से बच्चों की ओर वंशागत होती है, इसलिए डीएनए अंगुलिछापी विवाद की स्थिति में पैतृत्व परीक्षण में सहायक है।
डीएनए अनुक्रम में मिलने वाली बहुरूपता के साथ-साथ डीएनए अंगुलिछापी मानव जीनोम के आनुवंशिक नक्शे तैयार करने में लाभदायक है साधारण तौर से हमें यह समझ लेना चाहिए कि डीएनए बहुरूपता क्या है। बहुरूपता (आनुंवंशिक आधार पर विभिन्नता) उत्परिवर्तन के कारण ही उत्पन्न होता है। आप अध्याय 4 व इस अध्याय के पिछले खंडों में उत्परिवर्तन के विभिन्न प्रकार व उनके प्रभावों के बारे में पढ़ चुके हैं।) किसी व्यक्ति में नए उत्परिवर्तन उसकी कायिक कोशिकाओं या जनन कोशिकाओं (लैंगिक प्रजनन करने वाले जीवों उस कोशिका से युग्मक बनाते हैं) में पैदा होता है। यदि जनन कोशिका उत्परिवर्तन किसी व्यक्ति की संतानोत्पत्ति क्षमता को गंभीर रूप से प्रभावित नहीं करते तो यह उत्परिवर्तन स्थानांतरित होता है जिससे जनसंख्या के दूसरे सदस्यों (लैंगिक प्रजनन द्वारा) में यह फैल जाता है। विकल्पी (पुनः अध्याय 4 से विकल्पी की परिभाषा याद करो) अनुक्रम विभिन्नता जिसे परंपरागत रूप से डीएनए बहुरूपता कहते हैं। मानव जनसंख्या में 0.01 से अधिक आवृत्ति में एक विस्थल में असंगति मिलने से होती है। साधारण तौर से यदि एक वंशागत उत्परिवर्तन जनसंख्या में उच्च आवृत्ति से मिलता है तो इसे डीएनए बहुरूपता कहते हैं। उपरोक्त विभिन्नता की संभावना अव्यक्तेक डीएनए अनुक्रम में ज्यादा होती है व इन अनुक्रमों में होने वाला उत्परिवर्तन व्यक्ति की प्रजनन क्षमता को प्रभावित नहीं कर पाता है। इस तरह के उत्परिवर्तन एक पीढ़ी से दूसरी पीढ़ी में एकत्रित होते रहते हैं जिसके फलस्वरूप विभिन्नता/बहुरूपता उत्पन्न होती है। बहुरूपता विभिन्न प्रकार की होती है जिसमें एक न्यूक्लियोटाइड में या विस्तृत स्तर पर परिवर्तन होता है। विकास व जाति उद्भवन में उपरोक्त बहुरूपता की बहुत बड़ी भूमिका होती है जिसके बारे में आप उच्च कक्षाओं में विस्तृत रूप से पढ़ेंगे।
डीएनए अंगुलिछापी तकनीक का प्रारंभिक विकास एलेक जेफ़रीज द्वारा किया गया। इन्होंने अनुषंगी डीएनए को प्रोब के रूप में उपयोग किया जिसमें काफी बहुरूपता मिलती है। इसे अनुबद्ध पुनरार्तक की विभिन्न संख्या (वैरिएबल नंबर आफ टेंडेम रिपीट, वी एन टी आर) के रूप में जानते हैं। तकनीक जैसा पहले उपयोग किया जा चुका है, वह सदर्न ब्लाट हाइब्रिडाइजेसन है। जिसमें विकिरण चिह्नित वीएनटी आर एक प्रोब के रूप में प्रयोग किया जाता है। इसमें शामिल है -
(क) डीएनए का विलगन
(ख) प्रतिबंधन एंडान्यूक्लिएज द्वारा डीएनए का पाचन
(ग) इलेक्ट्रोफोरेसिस द्वारा डीएनए खंडों का पृथक्करण
(घ) पृथक्कृत डीएनए खंडों का संश्लेषित झिल्ली जैसे - नाइट्रोसेलुलोज या नाइलान पर स्थानांतरण (ब्लाटिंग)
(ङ) चिह्नित वी एन टी आर प्रोब का उपयोग करते हुए संकरण व
(च) स्वविकिरणी चित्रण द्वारा संकरित डीएनए खंडों का पता लगाना। डीएनए अंगुलिछापी चित्रीय प्रदर्शन चित्र 5.16 में दिखाया गया है।
वीएनटीआर अनुषंगी डीएनए की श्रेणी से संबंधित है इसलिए इसे लघुअनुषंगी कहते है। इसमें एक छोटा डीएनए अनुक्रम बहुरूपीय संख्या में अनुबद्धीय व्यवस्थित होता है। किसी व्यक्ति के एक गुणसूत्र से दूसरे गुणसूत्र की रूपीय संख्या में विभिन्नता मिलती है। पुनरावृत्तों की संख्या में बहुत उच्च श्रेणी की बहुरूपता मिलती है। जिसके फलस्वरूप वीएनटीआर के आकार परिवर्तित होते रहते हैं इनके आकार 0.1 से 20 किलोबेस के होते हैं। वीएनटीआर प्रोब से संकरण के फलस्वरूप प्राप्त स्वविकिरण चित्र में विभिन्न आकार की पट्टियाँ दिखायी पड़ती हैं। ये पट्टियाँ किसी व्यक्ति के डीएनए की विशिष्ट प्रारूप को व्यक्त करती हैं (चित्र 5.16)। ये पट्टियाँ एकयुग्मज (समरूपी) जुड़वाँ को छोड़कर किसी भी जनसंख्या के एक व्यक्ति से दूसरे व्यक्ति में भिन्न-भिन्न होती है (चित्र 5.16)। पॉलीमरेज श्रृंखला अभिक्रिया का उपयोग कर तकनीक की संवेदनशीलता को बढ़ा सकते हैं (पीसीआर के बारे में तुम अध्याय 9 में पढ़ोगे)। इसके फलस्वरूप किसी भी एक कोशिका से प्राप्त डीएनए से पर्याप्त डीएनए अंगुलिछापी विश्लेषण किया जा सकता है। न्यायालयीन विज्ञान में उपयोग के अतिरिक्त इसका बहुत अधिक उपयोग है जैसे- जनसंख्या व आनुवंशिक विभिन्नता के निर्धारण में। वर्तमान समय में कई प्रकार के संपरीक्षक का उपयोग डीएनए अंगुलिछाप बनाने में किया जा रहा है।
चित्र 5.16 कुछ प्रतिनिधि गुणसूत्र में डीएनए अंगुलिछापी का चित्रात्मक प्रदर्शन जिनमें वीएनटीआर के विभिन्न प्रतिरूप संख्या दर्शाये गये हैं। समझने हेतु विभिन्न रंग योजन का उपयोग जेल में स्थित प्रत्येक पट्टी के उद्गम का पता लगाने में किया गया है। एक गुणसूत्र के दो एलील्स (पैतृक व मातृक) में वीएनटीआर के विभिन्न प्रतिरूप संख्या स्थित है। अपराधिक पृष्ठभूमि यह साबित होता है कि डीएनए के पट्टीदार नमूने व्यक्तिगत बी से मिलता जुलता है।
सारांश
न्यूक्लिक अम्ल न्यूक्लियोटाइड्स का एक लंबा बहुलक है। डीएनए आनुवंशिक सूचनाओं को संग्रहित करने जबकि आरएनए मुख्यतया सूचनाओं के स्थानांतरण व अभिव्यक्ति में सहायता करते हैं। डीएनए व आरएनए दो आनुवंशिक पदार्थ के रूप में कार्य करते हैं, लेकिन डीएनए रासायनिक व संरचनात्मक अधिक स्थिर होने से उपयुक्त आनुवंशिक पदार्थ है। फिर भी आरएनए सबसे पहले विकसित हुआ जबकि डीएनए आरएनए से प्राप्त हुआ। डीएनए के द्वि श्रृंखला कुंडलित संरचना की विशिष्टता उसके विपरीत रज्जुकों के बीच उपस्थित हाइड्रोजन बंध है। नियम के अनुसार एडेनिन थाइमिन से दो हाइड्रोजन बंध द्वारा जुड़ा होता है जबकि ग्वानिन व साइटोसीन तीन हाइड्रोजन बंध द्वारा जुड़े होते हैं। इससे एक रज्जुक दूसरे के पूरक होते हैं डीएनए की प्रतिकृति सेमीकंजरवेटिव ढंग से होती है जबकि यह प्रक्रम पूरक हाइड्रोजन बंध द्वारा निर्देशित होता है। साधारण ढंग से कहा जाए तो डीएनए का यह खंड जो आरएनए का कूटलेखन करता है उसे जीन कहते हैं। अनुलेखन के दौरान डीएनए का एक रज्जुक टेम्पलेट के रूप में कार्य करता है जो पूरक आरएनए के संश्लेषण में दूत आरएनए को सक्रिय करता हुआ स्थानांतरित हो जाता है। जीवाणुओं में अनुलेखित एमआरएनए क्रियात्मक होता है अतः वह सीधे ही हो जाता है। सुकेंद्रीय में जीन विखंडित होते है। व्यक्तेक अनुक्रम एक्जान के बीच में अव्यक्तेक अनुक्रम इंट्रान मिलता है। इंट्रान को अलगकर व एक्जान को स्पलाइसिंग द्वारा आपस में जोड़कर सक्रिय आरएनए का निर्माण करते हैं। दूत आरएनए में मिलने वाले क्षार अनुक्रमों को तीन के समूहों में पढ़ते हैं (त्रिक आनुवंशिक कूट का निर्माण) जो एक एमीनो अम्ल का कूटलेखन करते हैं। अंतरण आरएनए द्वारा आनुवंशिक कूट को पूरकता के सिद्धांत पर पढ़ा जाता है जो एक अनुकूलक अणु के रूप में कार्य करता है। प्रत्येक एमीनो अम्ल के लिए विशिष्ट अंतरण आरएनए होते हैं। टी आरएनए विशिष्ट एमीनो अम्ल को अपने एक किनारे से जोड़ता है व दूत आरएनए पर स्थित कूट से अपने एंटीकोडान के बीच हाइड्रोजन बंध बनाकर युग्मित होता है। स्थानांतरण स्थल (प्रोटीन संश्लेषण) राइबोसोम है, जो दूत आरएनए से जुड़कर एमीनो अम्लों को जोड़ने के लिए पेप्टाइड बंध बनाने के लिए उत्प्रेरक का काम करता है जो एक आरएनए एंजाइम (राइबोजाइम) का उदाहरण है। स्थानांतरण एक प्रक्रम है जिसका विकास आरएनए के इर्दगिर्द हुआ है जो इस बात का सूचक है कि जीवन का विकास आरएनए से हुआ है। चूँकि अनुलेखन व स्थानांतरण उर्जात्मक एक बहुत मँहगी प्रक्रिया है, इसलिए यह दृढ़ता पूर्वक नियमित होते हैं। अनुलेखन का नियमन जीन की अभिव्यक्ति के नियमन का प्रथम चरण है। जीवाणु में एक से अधिक जीन आपस में इस तरह से व्यवस्थित होते हैं कि वे एक ईकाई के रूप में नियमित होते हैं जिसे प्रचालेक कहते है। लैक-ओपेरान जीवाणु में आद्यरूप का प्रचालेक है जो लैक्टोज के उपापचय के लिए जीन के कूटलेखन के लिए उत्तरदायी हैं। प्रचालेक का नियमन संवर्धन में उपस्थित लैक्टोज की मात्रा पर निर्भर है, जहाँ जीवाणु की वृद्धि होती है। इस कारण से इस प्रकार के नियमन को क्रियाधार के द्वारा एंजाइम संश्लेषण के नियमन के रूप में देख सकते हैं।
मानव जीनोम परियोजना एक वृहद् योजना थी जिसका उद्देश्य मानव जीनोम में स्थित सभी क्षारों का अनुक्रम करना था। इस परियोजना से बहुत नयी सूचनाएँ प्राप्त हुई। इस परियोजना के फलस्वरूप कई नए क्षेत्रों व अवसरों के रास्ते खुले। डीएनए अंगुलिछापी एक तकनीक है जिसमें डीएनए के स्तर पर एक जनसंख्या में स्थित विभिन्न लोगों के बीच विभिन्नता के बारे में पता लगाते हैं। यह डीएनए अनुक्रम में बहुरूपता के सिद्धांत पर कार्य करता है। इसका न्यायालयीन विज्ञान, आनुवंशिक विविधता व विकासीय जीव विज्ञान के क्षेत्र में अत्याधिक उपयोग है।
अभ्यास
1. निम्न को नाइट्रोजनीकृत क्षार व न्यूक्लियोटाइड के रूप में वर्गीकृत कीजिए एडेनीन, साइटीडीन, थाइमीन, ग्वानोसीन, यूरेसील व साइटोसीन
Show Answer
Answer
#/missing
2. यदि एक द्विरज्जुक डीएनए में 20 प्रतिशत साइटोसीन है तो डीएनए में मिलने वाले एडेनीन के प्रतिशत की गणना कीजिए।
Show Answer
Answer
#/missing
3. यदि डीएनए के एक रज्जुक के अनुक्रम निम्नवत लिखें है-
5’-ATGCATGCATGCATGCATGCATGCATGC-3’
तो पूरक रज्जुक के अनुक्रम को $5^{4} \rightarrow 3^{4}$ दिशा में लिखे।
Show Answer
Answer
#/missing
4. यदि अनुलेखन ईकाई में कूटलेखन रज्जुक के अनुक्रम को निम्नवत लिखा गया है-
5’-ATGCATGCATGCATGCATGCATGCATGC-3’
तो दूत आरएनए के अनुक्रम को लिखें।
Show Answer
Answer
#/missing
5. डीएनए द्विकुंडली की कौन सी विशेषता वाटसन व क्रिक को डीएनए प्रतिकृति के सेमी-कंजर्वेटिव रूप को कल्पित करने में सहयोग किया; इसकी व्याख्या कीजिए।
Show Answer
Answer
#/missing
6. टेंपलेट (डीएनए या आरएनए) के रासायनिक प्रकृति व इससे (डीएनए या आरएनए) संश्लेषित न्यूक्लिक अम्लों की प्रकृति के आधार पर न्यूक्लिक अम्ल पालीमरेज के विभिन्न प्रकार की सूची बनाइए।
Show Answer
Answer
#/missing
7. डीएनए आनुवंशिक पदार्थ है, इसे सिद्ध करने हेतु अपने प्रयोग के दौरान हर्षे व चेस ने डीएनए व प्रोटीन के बीच कैसे अंतर स्थापित किया?
Show Answer
Answer
#/missing
8. निम्न के बीच अंतर बताइए -
(क) पुनावृत्ति डीएनए एवं अनुषंगी डीएनए
(ख) एमआरएनए और टीआरएनए
(ग) टेम्पलेट रज्जु और कोडिंग रज्जु
Show Answer
Answer
#/missing
9. स्थानांतरण के दौरान राइबोसोम की दो मुख्य भूमिकाओं की सूची बनाइए।
Show Answer
Answer
#/missing
10. उस संवर्धन में जहाँ ई.कोलाई वृद्धि कर रहा हो लैक्टोज डालने पर लैक-ओपेरान उत्प्रेरित होता है। तब कभी संवर्धन में लैक्टोज डालने पर लैक ओपेरान कार्य करना क्यों बंद कर देता है?
Show Answer
Answer
#/missing
11. निम्न के कार्यों का वर्णन (एक या दो पंक्तियों से) करो -
(क) उन्नायक ( प्रोमोटर)
(ख) अंतरण आरएनए (tRNA)
( ग) एक्जान
Show Answer
Answer
#/missing
12. मानव जीनोम परियोजना को महापरियोजना क्यों कहा गया।
Show Answer
Answer
#/missing
13. डी एन ए अंगुलिछापी क्या है। इसके उपयोगिता पर प्रकाश डालिए।
Show Answer
Answer
#/missing
14. निम्न का संक्षिप्त वर्णन कीजिए-
(क) अनुलेखन
(ख) बहुरूपता
(ग) स्थानांतरण
(घ) जैव सूचना विज्ञान
Show Answer
Answer
#/missing
